View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_63 (Length: 302)
Name: NF2272_low_63
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_63 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 261
Target Start/End: Original strand, 30798870 - 30799112
Alignment:
| Q |
19 |
catggcgcatgaaccagggagcatttctcgttctgcattcttcatgatgcctggagcacatggatcagaggcaaaatcccttattttcttcattatgtgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30798870 |
catggcgcatgaaccagggagcatttctcgttctgcattctacatgatgcctggagcacatggatcagaggcaaaatcccttattttcttcattctgtgt |
30798969 |
T |
|
| Q |
119 |
tattttcatcattgatatgcatttgggacttgagacacaatttccttaagttattttgtcttcacatcttcgttgtgatcgatcttataacttcaatatc |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
30798970 |
tattttcatcattgatatgcgtttgggacttgagacacaatttccttaagttattttgtcttcacatcttcattgtgctcgatcttataacttcaatatc |
30799069 |
T |
|
| Q |
219 |
tttcgtgagatttcttgttttgtcgagttacatgatttatacc |
261 |
Q |
| |
|
|| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30799070 |
ttccatgagatttcttgttttgtcgagttacatgatttatacc |
30799112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University