View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_68 (Length: 293)
Name: NF2272_low_68
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 15 - 169
Target Start/End: Complemental strand, 25115953 - 25115799
Alignment:
| Q |
15 |
acattaatcacaaattgatactcatgtgatcctattttgtgcatttatttatcactaaatagcttggaatattgcacaattgttattgtaccaattatta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25115953 |
acattaatcacaaattgatactcatgtgatcctattttgtgcatttatttatcactaaatagcttggaatattacacaattgttattgtaccaattatta |
25115854 |
T |
 |
| Q |
115 |
gctttgaatcaattattgttgttaacctaattagaattcacctaaatacaacttt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25115853 |
gctttgaatcaattattgttgttaacctaattagaattcacctaaatacaacttt |
25115799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 179 - 238
Target Start/End: Complemental strand, 25115665 - 25115607
Alignment:
| Q |
179 |
aaaaccgttaaaatacttgtttatcatgttttagttttatttattttaaacatataaaaa |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25115665 |
aaaaccgttaaaatacttttttatcatgttt-agttttatttattttaaacatataaaaa |
25115607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University