View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_71 (Length: 271)
Name: NF2272_low_71
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 11 - 212
Target Start/End: Original strand, 33613906 - 33614110
Alignment:
| Q |
11 |
taggtaaagggacatgcccaaaaaatatctttaagacctattgatggaagctgaaatttgtcggggccggatatgatttttcaactgtgattatctttac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33613906 |
taggtaaagggacatgcccaaaaaatatctttaagacctatt-atggaagctgaaatttgtcggggccggatgtgatttttcaactgtgattatctttac |
33614004 |
T |
 |
| Q |
111 |
ttcaagtaaatgatgcagagggaataa----gtctctcagctttggtttccataacttctttagtagagtgttagatacgattgtttttgggtttaagat |
206 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
33614005 |
ctcaagcaaatgatgcagagggaataactttgtctctcagctttggtttccataacttctttagtagagcgttagatacgattgtttttggatttaagat |
33614104 |
T |
 |
| Q |
207 |
atacac |
212 |
Q |
| |
|
|||||| |
|
|
| T |
33614105 |
atacac |
33614110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University