View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_75 (Length: 265)
Name: NF2272_low_75
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 26547157 - 26547406
Alignment:
| Q |
1 |
aatgataacgtttactctgatggtagtttagatcaaactgactcgttttggcaagtgtatagtctgaagagtaacaaatggaaaccattagatggtgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26547157 |
aatgataacgtttactctgatggtagtttagatcaaactgactcgttttggcaagtgtatagtctgaagagtaacaaatggaaaccattagatggtgttc |
26547256 |
T |
 |
| Q |
101 |
gtcttccatttcttcagtataaccctaatggtttggaggtctacttggatggtgtttgtcattggctaggcagnnnnnnnncaaatggtcaactttttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
26547257 |
gtcttccatttcttcagtataaccctaatggtttggaggtctgcttggatggtgtttgtcattggctaggcagaaaagaaacaaatagtcaactttttct |
26547356 |
T |
 |
| Q |
201 |
tgtgtcattcaacttggaggcattcaactcggcacttacaccagtggatg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26547357 |
tgtgtcattcaacttggaggcattcaactcggcacttacaccagtggatg |
26547406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 104 - 216
Target Start/End: Original strand, 26540565 - 26540674
Alignment:
| Q |
104 |
ttccatttcttcagtataaccctaatggtttggaggtctacttggatggtgtttgtcattggctaggcagnnnnnnnncaaatggtcaactttttcttgt |
203 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |||||||||||| |||| |||||| | ||||| || |||||||||||| ||| || |
|
|
| T |
26540565 |
ttccatttcatcagtattaccctaatggtttggaggtttacttggatggtttttgccattggttgggcag---agtcgcatatggtcaactttatctcgt |
26540661 |
T |
 |
| Q |
204 |
gtcattcaacttg |
216 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26540662 |
gtcattcaacttg |
26540674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University