View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_83 (Length: 250)
Name: NF2272_low_83
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_83 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 22 - 250
Target Start/End: Complemental strand, 39718835 - 39718607
Alignment:
| Q |
22 |
tttttaattagaagtgtcgcaatattttagagtttgtttggagttgaagcatttaaattgttttaagagagagaatcgacatggtacgacacagttgata |
121 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
39718835 |
tttttaattagaagtgttgcagtattttagagtttgtttggagttgaagcattcaaattgttttaagaaagagaatcgacatggtgcgacacagttgata |
39718736 |
T |
 |
| Q |
122 |
aattatcatcttagtaaatgatttgatcttaaattgatgcatatgaaagaatatatgtatccctttatatgaattgaagtatttgaaggaattagtctct |
221 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39718735 |
aattatcatcttagtaaatgatttgattttaaattgatgcatatgaaagaatatatgtatccctttatatgaattgaagtatttgaaggaattagtctct |
39718636 |
T |
 |
| Q |
222 |
aactatagattgaaataaatagtattcat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39718635 |
aactatagattgaaataaatagtattcat |
39718607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University