View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2272_low_93 (Length: 235)
Name: NF2272_low_93
Description: NF2272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2272_low_93 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 22 - 219
Target Start/End: Complemental strand, 4709832 - 4709635
Alignment:
| Q |
22 |
aacgcctctcagtttcatctccacgcttttatttttagctgctacattatgtcattgactgatcaaaaaatcttttggctttgataaatatgacagggtc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4709832 |
aacgcctctcagtttcatctccacgcttttatttttagctgctacattatgtcattgactgatcaaaaaatcttttggctttgataaatatgacagggtc |
4709733 |
T |
|
| Q |
122 |
tgatgtccttatcgctgtcatcgtacctcttcttgattaaacctaaaggttgtgggaatgaatcaattcaatgtggaaaacattcaagttgggagatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4709732 |
tgatgtccttatcgctgtcatcgtacctcttcttgattaaacctaaaggttgtgggaatgaatcaattcaatgtggaaaacattcaagttgggagatg |
4709635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University