View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2273_high_15 (Length: 238)
Name: NF2273_high_15
Description: NF2273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2273_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 34 - 209
Target Start/End: Original strand, 42344808 - 42344982
Alignment:
| Q |
34 |
ataaattctaattggaacgaatggaatattattatttttgttattaaaaataaaatgatattttctgttgtcttattttcctacacccatagaagactta |
133 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42344808 |
ataaattctaattggaacggatggaatattattatttttgttattaaaaataaaatgatattttctgttgtcttattttcctacacccatagaagactta |
42344907 |
T |
 |
| Q |
134 |
acacttgactttgtttgagaaacatatggggaagggaaaataaaagtatactataaaagggatttttagttgtttg |
209 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42344908 |
acacttgactttgtttgaaaaacatat-gggaagggaaaataaaagtatactataaaagggatttttagttgtttg |
42344982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University