View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2273_high_9 (Length: 279)
Name: NF2273_high_9
Description: NF2273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2273_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 50 - 262
Target Start/End: Complemental strand, 39718433 - 39718225
Alignment:
| Q |
50 |
ttctatgcaattcacatttaatttatttagcttggttcatgtatttttgnnnnnnnnnnnnnnnnggagtcttcgttctttacccttttaagtcctgttt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39718433 |
ttctatgcaattcacatttaatttatttagcttggttcatgtatttttgaaaaaagaaaaaaaaaggagtcttcgttctttacccttttaagtcctgttt |
39718334 |
T |
|
| Q |
150 |
cttattgccatgtgggtccctcccttgcactaccttatgatcactcaactcatttgctagctatctttgacattcatcattttgtgacaacaataaagtg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39718333 |
cttattgccatgtgggtccctcccttgcactaccttatgatcactcaactcattt----gctatctttgacattcatcattttgtgacaacaataaagtg |
39718238 |
T |
|
| Q |
250 |
tgatccctccttc |
262 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39718237 |
tgatccctccttc |
39718225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University