View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2273_low_12 (Length: 254)
Name: NF2273_low_12
Description: NF2273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2273_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 129 - 235
Target Start/End: Original strand, 5313402 - 5313508
Alignment:
| Q |
129 |
aaatgggggcactatgcatctgaatgcaggtctaagagatttcaaaggaataaaggtgatgaagcacaatttgatcataatgattgttatgactcaaatg |
228 |
Q |
| |
|
||||||||||| |||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5313402 |
aaatgggggcaatatgaatctgaatgtaggtctaagagagttcaaaggaataaaggtgatgaagcacaatttgatcataatgattgttatgactcaaatg |
5313501 |
T |
|
| Q |
229 |
aagtctt |
235 |
Q |
| |
|
||||||| |
|
|
| T |
5313502 |
aagtctt |
5313508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University