View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2273_low_14 (Length: 248)
Name: NF2273_low_14
Description: NF2273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2273_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 9 - 237
Target Start/End: Complemental strand, 42344759 - 42344532
Alignment:
| Q |
9 |
gatagtgtcattaataagtggatggtggaaatagagacaggacatgttccctaatacagtctggtataataattttaatttaattatatctcattgttat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
42344759 |
gatagtgtcattaataagtggatggtggaaatagagacaggacatgttccctaatacagtctggtataataattt-aatttaaatatatctcattgttat |
42344661 |
T |
 |
| Q |
109 |
gaccaaagttgtttcttgtctgggagcaacctagtggcaaagaaaaactcaaaacgcgcaatgtatttttatgctatagcacatatgaatatccaaattg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
42344660 |
gaccaaagttgtttcttgtctgggagcaacctagtggcaaagaaaaactcaaaacgcgcagtgtatttttatactatagcacatatgaatatccacattg |
42344561 |
T |
 |
| Q |
209 |
ctgtctcctatagcaaggtgggggatatt |
237 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
42344560 |
ctgtctactatagcaaggtgggggatatt |
42344532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University