View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2273_low_20 (Length: 237)
Name: NF2273_low_20
Description: NF2273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2273_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 17 - 153
Target Start/End: Original strand, 23698238 - 23698374
Alignment:
| Q |
17 |
agaaggattgaactcatgcaatacgttggaatttcttgagctactgatttcactgacacttctctaacttctttcgataaatatttgtcggaccatcctt |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23698238 |
agaaggattgaactcatgcaatccgttggaatttcttgagctactgatctcactgacacttctctaacttctttcgataaatatttgtcggaccatcctt |
23698337 |
T |
 |
| Q |
117 |
ggttcttcttccacattctatttttgaggtatctaaa |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23698338 |
ggttcttcttccacattctatttttgaggtatctaaa |
23698374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 143
Target Start/End: Original strand, 36719278 - 36719399
Alignment:
| Q |
23 |
attgaactcatgcaatacgttggaatttcttgagctactgatttcactgacacttctctaacttc-tttcgataaatatttgtcggaccatccttggttc |
121 |
Q |
| |
|
|||||||||||| | || ||||||| |||||||| |||| |||||||| ||| ||||||| || | ||| ||||||| ||| | || ||| |||||| || |
|
|
| T |
36719278 |
attgaactcatgtagtaggttggaaattcttgagatactcatttcactaacaattctctacctgctttttgataaatctttctaggtccacccttggatc |
36719377 |
T |
 |
| Q |
122 |
ttcttccacattctatttttga |
143 |
Q |
| |
|
||||||||| || ||| ||||| |
|
|
| T |
36719378 |
ttcttccacgttttatctttga |
36719399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 217
Target Start/End: Original strand, 23698374 - 23698404
Alignment:
| Q |
187 |
atacctaaataccttcatctttcgatacatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23698374 |
atacctaaataccttcatctttcgatacatt |
23698404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University