View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2273_low_25 (Length: 208)

Name: NF2273_low_25
Description: NF2273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2273_low_25
NF2273_low_25
[»] chr4 (3 HSPs)
chr4 (18-192)||(55271442-55271612)
chr4 (69-198)||(55265531-55265660)
chr4 (18-56)||(55265687-55265725)
[»] chr2 (1 HSPs)
chr2 (103-192)||(8302964-8303053)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 55271612 - 55271442
Alignment:
18 taacttttgttagattattgattgcatgcttaaaatacatatataccatcatcatattcatattcatgtcttggatatggttctttcaggttttatactg 117  Q
    |||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55271612 taacttttgttagattattgattgcatgcttaaaatacata----ccatcatcatattcatattcatgtcttggatatggttctttcaggttttatactg 55271517  T
118 aggctcttgggatgaaacttttgaggcagagagatgttcctgaggagaaatatgccaacgcttttgttggatttg 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||    
55271516 aggctcttgggatgaaacttttgaggcagagagatgttcctgaggagaaatatgccaatgcttttcttggatttg 55271442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 69 - 198
Target Start/End: Complemental strand, 55265660 - 55265531
Alignment:
69 tcatattcatattcatgtcttggatatggttctttcaggttttatactgaggctcttgggatgaaacttttgaggcagagagatgttcctgaggagaaat 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55265660 tcatattcatattcatgtcttggatatggttctttcaggttttatactgaggctcttgggatgaaacttttgaggcagagagatgttcctgaggagaaat 55265561  T
169 atgccaacgcttttgttggatttgatgatg 198  Q
    |||||||||||||||||||||||| |||||    
55265560 atgccaacgcttttgttggatttggtgatg 55265531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 56
Target Start/End: Complemental strand, 55265725 - 55265687
Alignment:
18 taacttttgttagattattgattgcatgcttaaaataca 56  Q
    |||||||||||||||||||||||||||||||||||||||    
55265725 taacttttgttagattattgattgcatgcttaaaataca 55265687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 192
Target Start/End: Complemental strand, 8303053 - 8302964
Alignment:
103 tcaggttttatactgaggctcttgggatgaaacttttgaggcagagagatgttcctgaggagaaatatgccaacgcttttgttggatttg 192  Q
    |||||||||| ||||| ||| |||| ||||| ||||||||| | ||||||||||| ||||||||||| ||||| |||||| |||||||||    
8303053 tcaggttttacactgaagcttttggaatgaagcttttgaggaaaagagatgttccagaggagaaatacgccaatgcttttcttggatttg 8302964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University