View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2273_low_8 (Length: 370)
Name: NF2273_low_8
Description: NF2273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2273_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 265
Target Start/End: Complemental strand, 9969800 - 9969548
Alignment:
| Q |
13 |
aaaatggcataaaata-tttttaaaagagtctagcggcagcgaactcgatgaggaaaagaggagcatttcagggttcgagtctgcgaccccaacactctt |
111 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9969800 |
aaaatggcataaaatactttttaaaagagtctagcggaagcgaactcgatgaggaaaagaggaacatttcagggttcgagtctgcgaccccaacactcta |
9969701 |
T |
|
| Q |
112 |
ataaccccgagatagaaatattctcttaaattctttgtgcattgaatttttcaaaagtttaaaaactatttattttcgaacacaatttcttttgtttagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9969700 |
ataaccccgagatagaaatattctcttaaattctttgtgcattgaatttttcaaaagtttaaaaactatttattttcgaacacaatttcttttgtttagg |
9969601 |
T |
|
| Q |
212 |
tcacttaacatataccctaagacgtaaattagtaagttgattgtaatataacac |
265 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9969600 |
ttacttaacatataccctaa-acgtaaattagtaagttgattgtaatataacac |
9969548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 316 - 353
Target Start/End: Complemental strand, 9969499 - 9969462
Alignment:
| Q |
316 |
gtgttcaggtatactctgcttctattcctactagaata |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9969499 |
gtgttcaggtatactctgcttctattcctactagaata |
9969462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University