View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2274_high_24 (Length: 299)
Name: NF2274_high_24
Description: NF2274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2274_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 282
Target Start/End: Original strand, 18729017 - 18729289
Alignment:
| Q |
19 |
aagcttaccttaacgaacttattggattcaggaatcagatcatgcttatacaaatggttaagctttgacttaatttatcaaacgaatcatttcaaaaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18729017 |
aagcttaccttaacgaacttattggattcaggaatcagatcatgcttatacaaatggttaagctttgacttaatttatcaaacgaatcatttcaaaaaag |
18729116 |
T |
|
| Q |
119 |
tgtgtaaaagagaagggaaagatgagaacaattatgagatgaaatccttaatgggacaaggatgaaaaataatggtgaacaaagagatacgttgactatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18729117 |
tgtgtaaaagagaagggaaagatgagaacaattatgagatgaaatccttaatgagacaaggatgaaaaataatggtgaacaaagagatacgttgactatc |
18729216 |
T |
|
| Q |
219 |
aatatggaatatcactctca--------atttatttattcttcgttgctgaaggtcac-acgaagctgcctat |
282 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
18729217 |
aatatggaatatcactctcaatttatttatttatttattcttcgttgctaaaggtcacaacgaagctgcctat |
18729289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University