View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2274_low_18 (Length: 387)
Name: NF2274_low_18
Description: NF2274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2274_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 40 - 180
Target Start/End: Original strand, 16689695 - 16689835
Alignment:
| Q |
40 |
ttctgtaataaatgtacaaaatgtacctgatccttgttaaatagtgcaggccaatccttcatttccacaagccttttagcaacatcgcgactcaaagaaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16689695 |
ttctgtaataaatgtacaaaatgtacctgatccttgttaaatagtgcaggccaatccttcatttccacaagccttttagcaacatcgcgactcaaagaaa |
16689794 |
T |
|
| Q |
140 |
ttctgtaattcaagtccccgaaccatataattcggctggag |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16689795 |
ttctgtaattcaagtccccgaaccatataattcggctggag |
16689835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 262 - 368
Target Start/End: Original strand, 16689928 - 16690034
Alignment:
| Q |
262 |
gtctctgcattataactttaaaactagttttgaatgatacttactcgtgatctaaaattttgtcaggcatcctactgtactgattcttgcaaatcttagg |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16689928 |
gtctctgcattataactttaaaactagttttgaatgatacttactcgtgatctaaaattttgtcaggcatcctactgtactgattcttgcaaatcttagg |
16690027 |
T |
|
| Q |
362 |
aaactga |
368 |
Q |
| |
|
||||||| |
|
|
| T |
16690028 |
aaactga |
16690034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University