View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2274_low_19 (Length: 381)
Name: NF2274_low_19
Description: NF2274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2274_low_19 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 16 - 381
Target Start/End: Complemental strand, 16509711 - 16509346
Alignment:
| Q |
16 |
cacattgagattaggaacttcatccaatgatttcaccgattcttgcgtctcgaaaaccacatcaacatcagaactttctaccttcgtttgaaccgttgat |
115 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
16509711 |
cacattgagattaggaacttcttccattgatttcaccgattcttgcgtctcaaaaactacatcaacatcagaactttctaccttcatttgaatcgttgat |
16509612 |
T |
|
| Q |
116 |
tcagcctccattgatttcatcgattcatcaacagaagcaactttcgtgttcgtagctttcaaaaaatcatcgaacgcaagcatcgaacgtggttcatcag |
215 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16509611 |
tcagcttccattgatttcaacgattcatcaacagaagcaactttcgtgttcgtagctttcaaaaaatcatcgaacgcaagcatcgaacgtcgttcatcag |
16509512 |
T |
|
| Q |
216 |
attccgtcttacactccaccaccgtctccgccgccggaggttgaaaagcgacggtgacagattttgcctcatcttcaaattcttgaggttcgtctttgac |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
16509511 |
attccgtcttacactccaccaccgtctccgccgccggaggttgaaaagcgacggtgacagattttgcctcatcttcaaattcgcgcggttcgtctttgac |
16509412 |
T |
|
| Q |
316 |
tttgatgatcgaagctttgcatgcatcagactcgtcagagttagggttttgattcggcggcgttgc |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16509411 |
tttgatgatcgaagctttgcatgcatcagactcgtcggagttagggttttgattcggcggcgttgc |
16509346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University