View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2274_low_30 (Length: 286)

Name: NF2274_low_30
Description: NF2274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2274_low_30
NF2274_low_30
[»] chr5 (4 HSPs)
chr5 (1-251)||(26841118-26841367)
chr5 (138-252)||(22482421-22482535)
chr5 (39-117)||(22482348-22482426)
chr5 (1-42)||(22477037-22477078)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 26841367 - 26841118
Alignment:
1 tttggcttaggcgatgaccgtggttgaaggcaacatattgagatatagggatagactttgtgaatagagagaatgaatgatttgaatt-ttttattggaa 99  Q
    |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||    
26841367 tttggcttaggcgatgacagtggttgaagacaacatattgagatatagggatagactttgtgaatagagagaaggaatgatttgaatttttttcttggaa 26841268  T
100 agtgaggaggatgggataatgcactttttcgaggatgagagatatcagtgttcacaacattggaaataaacacataagtggcgcattgaattccttgtgt 199  Q
    ||||||||||||| |||| ||||||||| |||||||  ||||||||||| ||||||||||||||||||||||||||||||||||    |||| || ||||    
26841267 agtgaggaggatgagatagtgcacttttccgaggat--gagatatcagtcttcacaacattggaaataaacacataagtggcgctgcaaatttctagtgt 26841170  T
200 ataggaataggcatcaacagatgagttgattgtgagagggaaaataggaata 251  Q
    ||||||||| |||||| |||||||||||||||||||||||||||||||||||    
26841169 ataggaatacgcatcagcagatgagttgattgtgagagggaaaataggaata 26841118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 138 - 252
Target Start/End: Original strand, 22482421 - 22482535
Alignment:
138 gagatatcagtgttcacaacattggaaataaacacataagtggcgcattgaattccttgtgtataggaataggcatcaacagatgagttgattgtgagag 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||| |||||| |||||||||||||||||||||    
22482421 gagatatcagtgttcacaacattggaaataaacacataagtggcgctttaaattccttttgtataggaatacgcatcagcagatgagttgattgtgagag 22482520  T
238 ggaaaataggaatag 252  Q
    |||||||||||||||    
22482521 ggaaaataggaatag 22482535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 39 - 117
Target Start/End: Original strand, 22482348 - 22482426
Alignment:
39 tgagatatagggatagactttgtgaatagagagaatgaatgatttgaattttttattggaaagtgaggaggatgggata 117  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||    
22482348 tgagatatagggatagactttgtgaatagagagaaggaatgatttgaattttttcttggaaagtgaggaggatgagata 22482426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 22477037 - 22477078
Alignment:
1 tttggcttaggcgatgaccgtggttgaaggcaacatattgag 42  Q
    |||||||||||||||||| |||||||||| ||||||||||||    
22477037 tttggcttaggcgatgactgtggttgaagacaacatattgag 22477078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University