View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2274_low_32 (Length: 281)
Name: NF2274_low_32
Description: NF2274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2274_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 278
Target Start/End: Complemental strand, 39667899 - 39667627
Alignment:
| Q |
16 |
atatatttaacaaaagtgctctttcaattatactacaat----------ttgcggggtgggtactaaagtgctcgtacccacgtcaatctcgacttaaat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39667899 |
atatatttaacaaaagtgctctttcaattatagtacataaactgtgtggttgcggggtgggtactaaagtgctcgtacccgcgtcaatctcgacttaaat |
39667800 |
T |
|
| Q |
106 |
ttgcgggtgattacacaaactcatgcccatactcaataatgtgggtatttttgcaggttcatattggacttatgttcaattgtcatccctaattttcccg |
205 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||| ||||||| |
|
|
| T |
39667799 |
ttgcggatgattacacaaactcatgcccatacttaataatgtgggtatttttgcaggttcatattgggcttaggtttaattgtcatccctaactttcccg |
39667700 |
T |
|
| Q |
206 |
gttcataacttaacataaatggtctatcatggtaaactaacataaaaacagtgtctttaatgtattgattaat |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39667699 |
gttcataacttaacataaatggtctatcatggtaaactaacataaaaacagtgtctttaatgtattgattaat |
39667627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University