View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2274_low_39 (Length: 238)
Name: NF2274_low_39
Description: NF2274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2274_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 2696815 - 2696924
Alignment:
| Q |
1 |
aaattgagaagaaactcttctcctcaatccaagttcgacatttttcaatctcacttgatagattttgctttttaatttagatatttcatttcattcttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2696815 |
aaattgagaagaaactcttctcctcaatccaagttcaacatttttcaatctcacttgatagattttgctttttaatttagatatttcatttcattcttaa |
2696914 |
T |
 |
| Q |
101 |
ctataatgca |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
2696915 |
ctataatgca |
2696924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 128 - 222
Target Start/End: Original strand, 2696910 - 2697004
Alignment:
| Q |
128 |
cttaactataatgcattaaaacattaaaacaacaacatatatagaatgatgaaattctgatgccataggttaaacagcagcaacaacgtggtaaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2696910 |
cttaactataatgcattaaaacattaaaacaacaacatatatagaatgatgaaattctgatgccataggttaaacagcagcaacaacgtggtaaa |
2697004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University