View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2275_low_3 (Length: 240)
Name: NF2275_low_3
Description: NF2275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2275_low_3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 7 - 240
Target Start/End: Complemental strand, 46629126 - 46628889
Alignment:
| Q |
7 |
ggatggccagtaaacataggtatacatcaaattaatagctataggcccatcttattcata--atagagtaagtaattaatttgcatatttgttttgatct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46629126 |
ggatggccagtaaacataggtatacatcaaattaatagctataggcccatcttattcatataatagagtaagtaattaatttgcatatttgttttgatct |
46629027 |
T |
 |
| Q |
105 |
gaaggatatattttcatatacaaaccactagttggcaatcacatggcatgtttac--atatgctcccccattttacaaggtgttctgttggaggaaacac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46629026 |
gaaggatatattttcatatacaaaccactagttggcaatcacatggcatgtttacatatatgctcccccattttacaaggtgttctgttggaggaaacac |
46628927 |
T |
 |
| Q |
203 |
cacctttggaattttcctcattgccttctctatgatgt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46628926 |
cacctttggaattttcctcattgccttctctatgatgt |
46628889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University