View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2275_low_5 (Length: 201)

Name: NF2275_low_5
Description: NF2275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2275_low_5
NF2275_low_5
[»] scaffold0016 (1 HSPs)
scaffold0016 (1-114)||(59462-59575)
[»] chr1 (2 HSPs)
chr1 (1-79)||(33212729-33212807)
chr1 (9-104)||(40173663-40173758)
[»] chr2 (3 HSPs)
chr2 (1-79)||(38260742-38260818)
chr2 (2-62)||(24845966-24846026)
chr2 (40-106)||(40068390-40068462)
[»] chr8 (1 HSPs)
chr8 (9-77)||(8003782-8003850)
[»] chr4 (3 HSPs)
chr4 (2-79)||(8354477-8354553)
chr4 (34-104)||(52476329-52476406)
chr4 (34-79)||(17558663-17558708)
[»] scaffold0189 (1 HSPs)
scaffold0189 (40-97)||(26234-26291)
[»] scaffold0181 (1 HSPs)
scaffold0181 (34-104)||(3202-3273)
[»] chr6 (1 HSPs)
chr6 (73-105)||(18367796-18367828)


Alignment Details
Target: scaffold0016 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 59575 - 59462
Alignment:
1 caaaatactttattttattaatatataaaatatatattgccgtgtccgtgtcctacgttttttcagattagccgtgtccatgtcgtgtcccgtgtccgtg 100  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||| ||| | |||||||    
59575 caaaatactttattttattaatatataaaatatatatcgccgtgtccgtgtcctacgtttttttagattagccgtgtccgtgtcgtatcctgcgtccgtg 59476  T
101 tccgtgcatcatag 114  Q
    ||||||||||||||    
59475 tccgtgcatcatag 59462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 75; Significance: 9e-35; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 33212729 - 33212807
Alignment:
1 caaaatactttattttattaatatataaaatatatattgccgtgtccgtgtcctacgttttttcagattagccgtgtcc 79  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
33212729 caaaatactttattttattaatatataaaatatatattgccgtgtccgtgtcctacgtttttttagattagccgtgtcc 33212807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 9 - 104
Target Start/End: Complemental strand, 40173758 - 40173663
Alignment:
9 tttattttattaatatataaaatatatattgccgtgtccgtgtcctacgttttttcagattagccgtgtccatgtcgtgtcccgtgtccgtgtccg 104  Q
    ||||||||||||| || |||| ||||||| ||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||    
40173758 tttattttattaacatgtaaagtatatatagccgtgtccgtgtcctaggtttttttagattagccgtgtccgtgtcgtgtcccgtgtccgtgtccg 40173663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 38260818 - 38260742
Alignment:
1 caaaatactttattttattaatatataaaatatatattgccgtgtccgtgtcctacgttttttcagattagccgtgtcc 79  Q
    |||||||| |||||||||| ||||||||||||||||| ||||||||  ||||||||||||||| ||||||| |||||||    
38260818 caaaatacattattttattcatatataaaatatatatagccgtgtc--tgtcctacgtttttttagattagtcgtgtcc 38260742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 2 - 62
Target Start/End: Original strand, 24845966 - 24846026
Alignment:
2 aaaatactttattttattaatatataaaatatatattgccgtgtccgtgtcctacgttttt 62  Q
    |||||| | ||||||||||| ||||||||||||||| ||||||||||||||||||||||||    
24845966 aaaatattgtattttattaaaatataaaatatatatagccgtgtccgtgtcctacgttttt 24846026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 106
Target Start/End: Original strand, 40068390 - 40068462
Alignment:
40 ccgtgtccgtgtcctacgttttttcagattagccgtgtccatgtc------gtgtcccgtgtccgtgtccgtg 106  Q
    ||||||| |||||||| ||||||| ||||||||||||||| ||||      ||||||||||||||||||||||    
40068390 ccgtgtcggtgtcctaggtttttttagattagccgtgtccgtgtccgtgtcgtgtcccgtgtccgtgtccgtg 40068462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 8003850 - 8003782
Alignment:
9 tttattttattaatatataaaatatatattgccgtgtccgtgtcctacgttttttcagattagccgtgt 77  Q
    ||||||||||||| || |||||||||||| |||||||||||||||||  |||||| |||||||||||||    
8003850 tttattttattaacatgtaaaatatatatagccgtgtccgtgtcctagatttttttagattagccgtgt 8003782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 2 - 79
Target Start/End: Complemental strand, 8354553 - 8354477
Alignment:
2 aaaatactttattttattaatatataaaatatatattgccgtgtccgtgtcctacgttttttcagattagccgtgtcc 79  Q
    |||||| | ||||||||||| ||||||||||||||| | ||||||||||| ||||||||||| ||||||| |||||||    
8354553 aaaatattgtattttattaaaatataaaatatatatagacgtgtccgtgtactacgtttttt-agattagtcgtgtcc 8354477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 52476406 - 52476329
Alignment:
34 atattgccgtgtccgtgtcctacgttttttcagattagccgt-------gtccatgtcgtgtcccgtgtccgtgtccg 104  Q
    |||| |||||||| |||||||| ||||||| |||||||||||       |||| ||||||||||||||||||||||||    
52476406 atatagccgtgtcggtgtcctaagtttttttagattagccgtgtcccgtgtccgtgtcgtgtcccgtgtccgtgtccg 52476329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 34 - 79
Target Start/End: Complemental strand, 17558708 - 17558663
Alignment:
34 atattgccgtgtccgtgtcctacgttttttcagattagccgtgtcc 79  Q
    |||| |||||||| |||||||| ||||||| |||||||||||||||    
17558708 atatagccgtgtcggtgtcctaagtttttttagattagccgtgtcc 17558663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0189 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0189
Description:

Target: scaffold0189; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 40 - 97
Target Start/End: Complemental strand, 26291 - 26234
Alignment:
40 ccgtgtccgtgtcctacgttttttcagattagccgtgtccatgtcgtgtcccgtgtcc 97  Q
    |||||||||||||||| ||||||| ||||||||||||||| ||  |||||||||||||    
26291 ccgtgtccgtgtcctaggtttttttagattagccgtgtccgtgctgtgtcccgtgtcc 26234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0181 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: scaffold0181
Description:

Target: scaffold0181; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 3202 - 3273
Alignment:
34 atattgccgtgtccgtgtcctacgttttttc-agattagccgtgtccatgtcgtgtcccgtgtccgtgtccg 104  Q
    |||| |||||||| |||||||| |||||||  |||||||| |||||| | ||||||||||| ||||||||||    
3202 atatagccgtgtcggtgtcctaggttttttttagattagctgtgtccgtttcgtgtcccgtctccgtgtccg 3273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 105
Target Start/End: Complemental strand, 18367828 - 18367796
Alignment:
73 cgtgtccatgtcgtgtcccgtgtccgtgtccgt 105  Q
    |||||||||||||||||| ||||||||||||||    
18367828 cgtgtccatgtcgtgtccggtgtccgtgtccgt 18367796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University