View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2277_high_22 (Length: 253)
Name: NF2277_high_22
Description: NF2277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2277_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 19 - 138
Target Start/End: Original strand, 30757966 - 30758085
Alignment:
| Q |
19 |
ttttatcctgccaatacttctgaggttgctccagtagcctgatctaaacctacgcatgagtttgcctttgtgaatgagtattgaaatctcgcttccactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757966 |
ttttatcctgccaatacttctgaggttgctccagtagcctgatctaaacctaggcatgagtttgcctttgtgaatgagtattgaaatctcgcttccactt |
30758065 |
T |
 |
| Q |
119 |
agaaattcgaagcacccccg |
138 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30758066 |
agaaattcgaagcacccccg |
30758085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 192 - 233
Target Start/End: Original strand, 30758083 - 30758124
Alignment:
| Q |
192 |
ccgacagtgaactaaaaatccctcaacctagggaaataacac |
233 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30758083 |
ccgacagtgaactaaaaatcccccaacctagggaaataacac |
30758124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University