View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2277_high_29 (Length: 238)
Name: NF2277_high_29
Description: NF2277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2277_high_29 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 22 - 238
Target Start/End: Complemental strand, 5922708 - 5922492
Alignment:
| Q |
22 |
gtatgtgaaggtttattgtattacacatgttcacaactaagatggtaatcaaatggacacaaaacaaaataaaaactaatagcgtaatgctgcttatcac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
5922708 |
gtatgtgaaggtttattgtattacacatgttcacaactaagatggtaatcaaatggacacaaaacaaaataaaaactgatagcataatgctgcttatcac |
5922609 |
T |
 |
| Q |
122 |
gaaagatttccatgcgaaagtttcaccacagtttttctactcaannnnnnnnnatagcaccaccttccttgttttgtgggcaggcaaagaggtaattggt |
221 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5922608 |
gacagatttccatgcgaaagtttcaccacagtttttctactcaaattttttttatagcaccaccttccttgttttgtggccaggcaaagaggtaattggt |
5922509 |
T |
 |
| Q |
222 |
taactgctattcgcaat |
238 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5922508 |
taactgctattcgcaat |
5922492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 235
Target Start/End: Complemental strand, 15382262 - 15382202
Alignment:
| Q |
175 |
atagcaccaccttccttgttttgtgggcaggcaaagaggtaattggttaactgctattcgc |
235 |
Q |
| |
|
||||||||| ||| |||||||||||| |||||| |||||| ||||||||| || ||||||| |
|
|
| T |
15382262 |
atagcaccatcttacttgttttgtggccaggcatagaggtgattggttaagtgttattcgc |
15382202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University