View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2277_low_11 (Length: 397)
Name: NF2277_low_11
Description: NF2277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2277_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 144 - 382
Target Start/End: Original strand, 21601061 - 21601299
Alignment:
| Q |
144 |
gtcaccaaacacaagcagagacgtgtttacaaaatgtgtggataaacactgaatttcatgatttcattgtagccatagaaaaaacccttttatcaattta |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21601061 |
gtcaccaaacacaagcagagacgtgtttacaaaatgtgtggataaacactgaatttcatgatttcattgtagccatagaaaaaacccttttatcaattta |
21601160 |
T |
 |
| Q |
244 |
ccattttgttccttaacataacacattcacaaactccaagcatgcaatccatggctgtaaccaccacaacatggaagctcgcactgttcttgactcttat |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21601161 |
acattttgttccttaacataacacattcacaaactccaagcatgcaatccatggctgtaacaaccacaacatggaagcttgcactgttcttgactcttat |
21601260 |
T |
 |
| Q |
344 |
ctcagtttcattatcaggcactctttcatatgatattgt |
382 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21601261 |
ctcagtttcattatcaggtactctttcatatgatattgt |
21601299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University