View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2277_low_19 (Length: 274)
Name: NF2277_low_19
Description: NF2277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2277_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 12 - 258
Target Start/End: Original strand, 11557580 - 11557826
Alignment:
| Q |
12 |
tgaagaagagaacaggagggactaaagagaggatgacacgtgaggagaagctagagaaaaagtgacggacgtgacggagagaggaacggtgtgtgaccca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11557580 |
tgaagaagagaacaggagggactaaagagaggatgacacgtgaggagaagctagagaaaaagtgacgcacgtgacggagagaggaacggtgtgtgaccca |
11557679 |
T |
 |
| Q |
112 |
gtttgtgtggttgtagagtgttctgnnnnnnngcattcctcgttcttggttttggtctgcccagtctgggattgtacggaggagggtgattatggttttt |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11557680 |
gtttgtgtggttgtagagtgttctgtttttttgcattcctcgttcttggttttggtctgcccagtctgggattgtacggaggagggtgattatggttttt |
11557779 |
T |
 |
| Q |
212 |
attggagtggggggaggtgtggaagaacattttaggggggtgtgttt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11557780 |
attggagtggggggaggtgtggaagaacattttaggggggtgtgttt |
11557826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University