View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2277_low_24 (Length: 250)
Name: NF2277_low_24
Description: NF2277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2277_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 41966140 - 41965912
Alignment:
| Q |
1 |
caaggaataaggcttgaatggacttcatttcttttgctaagatgtggtatggaatccttagtatcttgattataattttttatgaaggacaaaagagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41966140 |
caaggaataaggcttgaatggacttcatttcttttgctaagatgtggtatggaatccttagtatcttgattataattttttatgaaggacaaaagagaga |
41966041 |
T |
|
| Q |
101 |
tggtgcgtctatatggtgcattaatacatgatgtcaaattaaagttcccctcaaaataaaaaatacttgatgtcaaagttggtacacgtgcaccatcaat |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41966040 |
tggtgtgtctatatggtgcattaatacatgatgtcaaattaaagttcccctcaaaataaaaaatacttgatgtcaaagttgg--cacgtgcaccatcaat |
41965943 |
T |
|
| Q |
201 |
ttaaccaattcaaatagagttctcatttatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41965942 |
ttaaccaattcaaatagagttctcatttatt |
41965912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 1227522 - 1227411
Alignment:
| Q |
1 |
caaggaataaggcttgaatggacttcatttcttttgctaagatgtggtatggaatccttagtatcttgattataattttttatgaaggacaaaagagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
1227522 |
caaggaataaggcttgaatggacttcatttcttttgctaagatgtggtgttgaa-ccttagtatctagattatagtttttt-tgaaggacaaaagagaga |
1227425 |
T |
|
| Q |
101 |
tggtgcgtctatat |
114 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
1227424 |
tggtgtgtctatat |
1227411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 173 - 233
Target Start/End: Complemental strand, 1227363 - 1227303
Alignment:
| Q |
173 |
tcaaagttggtacacgtgcaccatcaatttaaccaattcaaatagagttctcatttattgg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1227363 |
tcaaagttggtacacgtgcaccatcaatttaaccaattcaaatagagttctcatttattgg |
1227303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University