View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2278_high_6 (Length: 249)
Name: NF2278_high_6
Description: NF2278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2278_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 37843002 - 37843122
Alignment:
| Q |
1 |
ttgggaatgaagatggagttgccggagattctccatacggtggttttggcatcttccggtgagagaggtcttgcacggacggtgacgtgaattctctcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37843002 |
ttgggaatgaagatggagttgccggagattctccatacggtggttttggcatcttccggtgagagaggtcttgcacggacggtgacgtgaattctctcca |
37843101 |
T |
|
| Q |
101 |
tggtgagagaatgaagaaaga |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37843102 |
tggtgagagaatgaagaaaga |
37843122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 185 - 239
Target Start/End: Original strand, 37843180 - 37843234
Alignment:
| Q |
185 |
gtgtgacgaatttggactagaagtaagtacccaagacttgttcgttcctcctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37843180 |
gtgtgacgaatttggactagaagtaagtacccaagacttgttcgttcctcctttg |
37843234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University