View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2278_low_1 (Length: 464)
Name: NF2278_low_1
Description: NF2278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2278_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 2017970 - 2017625
Alignment:
| Q |
1 |
ccatggcgggcatttgtgaaggaatgcccatcatcgcagtgccatagactgcaatggcgtgtttgtatagatgatttttaaccatcggctatattc---- |
96 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2017970 |
ccatggcgggcatttgggaaggaatgcccatcatcgcagtgtcataggctgcaatggcgtgtttgtatagaggatttttaaccatcggctatattctgcc |
2017871 |
T |
|
| Q |
97 |
---cgccttagacaacattgaatgacaacactttgtcacaaaactcacatttcatccctaaattacgaaattatttgttcatcaaatattaacattttgt |
193 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
2017870 |
atccgccatagacaacattgattgacaacactttgtcacaaaactcacatttcatccctaaattacgaaattatttcttcctcaaatattaacattttgt |
2017771 |
T |
|
| Q |
194 |
atctcaaaatataacaaaaacattctcagttccaacac-annnnnnnnccattcacattccgcgaaatcaatggttgatgatgatgatctgcctcgacga |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2017770 |
atctcaaaatataacaaaaacattctcagttccaacactttttttttttcattcacattccgcgaaatcaatggttgatgatgatgatctgccgcgacgc |
2017671 |
T |
|
| Q |
293 |
gattaatatggtgcatgcatgcattttgttaagaacgcttattgtg |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2017670 |
gattaatatggtgcatgcatgcattttgttaagaacgcttattgtg |
2017625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 333 - 458
Target Start/End: Complemental strand, 2017324 - 2017189
Alignment:
| Q |
333 |
attgtggccgcaatttgcggtggaattgaatccgaaaaaatgatagagaataacctggatggagagttcttggcggccgatgatcaa----------ctc |
422 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
2017324 |
attgtgcccgcaatttgcggtggaattgaatccgaaaaaatgatagacaataacctggatggagagttcttggcgtccgatgatcaactacgtcgtgctc |
2017225 |
T |
|
| Q |
423 |
cggcgacgtttttaggaaagttgagttctgtgctgc |
458 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
2017224 |
cggcgacgttttcagggaagttgagttctgtgctgc |
2017189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 12 - 100
Target Start/End: Complemental strand, 2020434 - 2020346
Alignment:
| Q |
12 |
atttgtgaaggaatgcccatcatcgcagtgccatagactgcaatggcgtgtttgtatagatgatttttaaccatcggctatattccgcc |
100 |
Q |
| |
|
||||||||||||||||| || || | ||||||||| |||||||||| ||||| ||||| |||||||||||||| |||||| |||||| |
|
|
| T |
2020434 |
atttgtgaaggaatgcctgtcgtcacggtgccataggctgcaatggcttgtttatatagcggatttttaaccatcagctatactccgcc |
2020346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 2020161 - 2020115
Alignment:
| Q |
175 |
tcaaatattaacattttgtatctcaaaatataacaaaaacattctca |
221 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
2020161 |
tcaaatattaacattttttaccccaaaatataacaaaaacattctca |
2020115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University