View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2278_low_8 (Length: 240)
Name: NF2278_low_8
Description: NF2278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2278_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 82 - 225
Target Start/End: Complemental strand, 37842721 - 37842578
Alignment:
| Q |
82 |
aaggtactgttttcgcatatggacaaactaatagtggtaagactcatacaatgcgtggatccaaagctgagcctggagttattcctcgtgctgtacatga |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37842721 |
aaggtactgttttcgcatatggacaaactaatagtggtaagactcatacaatgcgtggatcgaaagctgagcctggagttattcctcgtgctgtacatga |
37842622 |
T |
|
| Q |
182 |
tttatttcaaattctcgaacaagtaacaattctgtgtcctctat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37842621 |
tttatttcaaattctcgaacaagtaacaattctgtgtcctctat |
37842578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 170 - 207
Target Start/End: Complemental strand, 37842233 - 37842196
Alignment:
| Q |
170 |
tgctgtacatgatttatttcaaattctcgaacaagtaa |
207 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
37842233 |
tgctgtacatcatttatttcaaattcttgaacaagtaa |
37842196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University