View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2279_high_9 (Length: 317)
Name: NF2279_high_9
Description: NF2279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2279_high_9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 99 - 317
Target Start/End: Original strand, 33233878 - 33234096
Alignment:
| Q |
99 |
attgtaagcaaaggaggaacagcactactaatgcatcgggttatgttatggaaacatgtgtttatctttatgggagtggaagcagaagaggttttcttgt |
198 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33233878 |
attgtaagcaaaggagtaacagcactactaatgcatcgggttatgttatggaaacatgtgtttatctttatgggagtggaagcagaagaggttttcttgt |
33233977 |
T |
 |
| Q |
199 |
gttggaagaaatgagaaagagtggaaatgctgaaaagccttgcaaggtaactgtagcacactattatgctgttagtattagaaatttgtttagttataaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33233978 |
gttggaagaaatgagaaagagtggaaatgctgaaaagccttgcaaggtaactgtagcacactattatgctgttagtattagaaatttgtttagttataaa |
33234077 |
T |
 |
| Q |
299 |
atagatattggtctttcta |
317 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33234078 |
atagatattggtctttcta |
33234096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University