View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2279_low_10 (Length: 317)

Name: NF2279_low_10
Description: NF2279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2279_low_10
NF2279_low_10
[»] chr6 (1 HSPs)
chr6 (99-317)||(33233878-33234096)


Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 99 - 317
Target Start/End: Original strand, 33233878 - 33234096
Alignment:
99 attgtaagcaaaggaggaacagcactactaatgcatcgggttatgttatggaaacatgtgtttatctttatgggagtggaagcagaagaggttttcttgt 198  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33233878 attgtaagcaaaggagtaacagcactactaatgcatcgggttatgttatggaaacatgtgtttatctttatgggagtggaagcagaagaggttttcttgt 33233977  T
199 gttggaagaaatgagaaagagtggaaatgctgaaaagccttgcaaggtaactgtagcacactattatgctgttagtattagaaatttgtttagttataaa 298  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33233978 gttggaagaaatgagaaagagtggaaatgctgaaaagccttgcaaggtaactgtagcacactattatgctgttagtattagaaatttgtttagttataaa 33234077  T
299 atagatattggtctttcta 317  Q
    |||||||||||||||||||    
33234078 atagatattggtctttcta 33234096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University