View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2280_high_5 (Length: 253)
Name: NF2280_high_5
Description: NF2280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2280_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 231
Target Start/End: Complemental strand, 17176401 - 17176176
Alignment:
| Q |
14 |
aaatcaagggacaatggacttcaaatgaggatcggtacatcaaatcatttaaaattttgcattgtcaatgcttattgttttaattttcaatttgattcat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||| |
|
|
| T |
17176401 |
aaatcaagggacaatggacttcaaatgaggatcggtatatcaaatcatttaaaattttgcatt-tcttttcttattgttttaattttcaatttgattcat |
17176303 |
T |
|
| Q |
114 |
cttaccttgat--tatannnnnnnncttctgttatttgttatcaattcttgacatatgataaacaatgattaat-------tatttttgtagggttcttg |
204 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17176302 |
cttaccttgattatatatttttttttttctgttatttgttatcaattcttgacatatgataaacaatgattaattattttatatttttgtagggttcttg |
17176203 |
T |
|
| Q |
205 |
tccaattggtggatcactttgggctta |
231 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
17176202 |
tccaattggtggatcactttgggctta |
17176176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 238
Target Start/End: Complemental strand, 34656525 - 34656473
Alignment:
| Q |
186 |
tatttttgtagggttcttgtccaattggtggatcactttgggcttaaaaaatg |
238 |
Q |
| |
|
||||||| |||||||||||| ||||||||| |||||||||| |||| |||||| |
|
|
| T |
34656525 |
tatttttttagggttcttgttcaattggtgaatcactttggtcttagaaaatg |
34656473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University