View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2280_low_5 (Length: 319)

Name: NF2280_low_5
Description: NF2280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2280_low_5
NF2280_low_5
[»] chr4 (18 HSPs)
chr4 (79-302)||(39298822-39299046)
chr4 (1-76)||(54420818-54420893)
chr4 (79-124)||(39298322-39298367)
chr4 (1-61)||(40859609-40859669)
chr4 (1-75)||(9661787-9661861)
chr4 (1-61)||(4634231-4634291)
chr4 (1-52)||(1657676-1657727)
chr4 (1-52)||(16991829-16991880)
chr4 (4-61)||(1646050-1646107)
chr4 (1-33)||(46729025-46729057)
chr4 (1-52)||(3168997-3169048)
chr4 (1-52)||(3673580-3673631)
chr4 (1-52)||(15730076-15730127)
chr4 (1-76)||(37869522-37869597)
chr4 (9-75)||(9474623-9474689)
chr4 (1-39)||(14542618-14542656)
chr4 (1-39)||(46829379-46829417)
chr4 (1-66)||(28588504-28588569)
[»] chr5 (14 HSPs)
chr5 (88-291)||(26878388-26878595)
chr5 (168-291)||(26897695-26897822)
chr5 (1-76)||(28618537-28618612)
chr5 (1-75)||(31645763-31645837)
chr5 (1-66)||(6887284-6887349)
chr5 (173-229)||(26898848-26898904)
chr5 (1-52)||(34894022-34894073)
chr5 (1-58)||(8812258-8812315)
chr5 (1-52)||(6648019-6648070)
chr5 (2-52)||(4070513-4070562)
chr5 (1-35)||(8957185-8957219)
chr5 (2-52)||(17326285-17326335)
chr5 (1-34)||(33486676-33486709)
chr5 (1-34)||(37424968-37425001)
[»] chr2 (21 HSPs)
chr2 (1-76)||(25516427-25516502)
chr2 (1-76)||(41176795-41176870)
chr2 (1-76)||(43566810-43566884)
chr2 (1-66)||(3464902-3464967)
chr2 (1-75)||(25771379-25771453)
chr2 (1-55)||(27191441-27191495)
chr2 (1-55)||(27841255-27841309)
chr2 (1-75)||(42105858-42105932)
chr2 (1-66)||(44167815-44167880)
chr2 (1-61)||(3390380-3390440)
chr2 (1-48)||(44951463-44951510)
chr2 (1-46)||(31263060-31263105)
chr2 (4-52)||(40125346-40125394)
chr2 (1-48)||(10588999-10589046)
chr2 (1-59)||(36507881-36507939)
chr2 (1-39)||(37883623-37883661)
chr2 (1-58)||(6089844-6089901)
chr2 (8-75)||(25623158-25623225)
chr2 (2-52)||(27024246-27024296)
chr2 (1-61)||(4878801-4878861)
chr2 (1-61)||(19581109-19581169)
[»] chr7 (13 HSPs)
chr7 (5-80)||(24470324-24470399)
chr7 (5-80)||(24475272-24475347)
chr7 (1-76)||(49166860-49166935)
chr7 (3-76)||(8611730-8611803)
chr7 (4-66)||(37399559-37399621)
chr7 (1-72)||(47749671-47749742)
chr7 (1-43)||(5237910-5237952)
chr7 (1-52)||(40775224-40775275)
chr7 (1-46)||(35141859-35141904)
chr7 (9-61)||(5025171-5025223)
chr7 (1-52)||(28015313-28015364)
chr7 (1-52)||(34595756-34595807)
chr7 (1-33)||(29804782-29804814)
[»] chr3 (23 HSPs)
chr3 (1-76)||(22286855-22286930)
chr3 (1-76)||(50519723-50519798)
chr3 (1-76)||(20201164-20201239)
chr3 (1-76)||(20203346-20203421)
chr3 (3-66)||(20251594-20251657)
chr3 (1-61)||(42106059-42106119)
chr3 (1-76)||(29776782-29776857)
chr3 (1-76)||(41882514-41882589)
chr3 (1-75)||(1165502-1165576)
chr3 (1-66)||(47914689-47914754)
chr3 (1-52)||(1806566-1806617)
chr3 (1-39)||(27831082-27831120)
chr3 (6-52)||(43029640-43029686)
chr3 (1-66)||(22843994-22844059)
chr3 (4-52)||(40796990-40797038)
chr3 (1-76)||(21803463-21803538)
chr3 (1-52)||(40462101-40462152)
chr3 (1-52)||(43839622-43839673)
chr3 (4-66)||(27056000-27056062)
chr3 (4-66)||(35501868-35501929)
chr3 (9-66)||(14741428-14741485)
chr3 (4-52)||(11846572-11846620)
chr3 (1-33)||(37051600-37051632)
[»] scaffold0045 (1 HSPs)
scaffold0045 (1-67)||(9754-9820)
[»] chr6 (8 HSPs)
chr6 (1-66)||(16913271-16913336)
chr6 (1-76)||(7049180-7049255)
chr6 (1-59)||(12576584-12576642)
chr6 (6-66)||(8633275-8633335)
chr6 (1-45)||(34020582-34020626)
chr6 (1-52)||(4663926-4663977)
chr6 (1-47)||(10744541-10744587)
chr6 (1-58)||(31804223-31804280)
[»] chr1 (10 HSPs)
chr1 (1-76)||(14717348-14717423)
chr1 (1-75)||(22345018-22345092)
chr1 (21-76)||(4564484-4564539)
chr1 (1-66)||(22032196-22032261)
chr1 (1-61)||(44514096-44514156)
chr1 (4-52)||(45658672-45658720)
chr1 (1-52)||(30853889-30853940)
chr1 (1-51)||(6212992-6213042)
chr1 (1-47)||(27469838-27469884)
chr1 (11-76)||(23257039-23257104)
[»] chr8 (18 HSPs)
chr8 (1-52)||(10042718-10042769)
chr8 (1-52)||(16937445-16937496)
chr8 (1-48)||(32256828-32256875)
chr8 (1-66)||(31874028-31874092)
chr8 (1-52)||(37129764-37129815)
chr8 (1-52)||(37719808-37719859)
chr8 (8-66)||(9269964-9270022)
chr8 (1-41)||(27534505-27534545)
chr8 (1-61)||(36545887-36545947)
chr8 (1-33)||(37658942-37658974)
chr8 (1-52)||(14327436-14327487)
chr8 (1-60)||(23766691-23766750)
chr8 (1-52)||(32061751-32061802)
chr8 (1-48)||(32920613-32920660)
chr8 (1-47)||(3680883-3680929)
chr8 (1-39)||(44295286-44295324)
chr8 (1-34)||(15665514-15665547)
chr8 (1-61)||(31713141-31713201)
[»] scaffold0012 (1 HSPs)
scaffold0012 (1-78)||(244565-244642)
[»] scaffold0009 (1 HSPs)
scaffold0009 (1-52)||(105009-105060)


Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 18)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 79 - 302
Target Start/End: Original strand, 39298822 - 39299046
Alignment:
79 aattctaacgtatacttttaaaagtagagtatatcataatt-atatatatactattctacttcctgtcattatgtttgtaacaattttttgtataaagat 177  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
39298822 aattctaacgtatacttttaaaagtagagtatatcataatttatatatatactattctacgtcctgtcattatgtttgtaacaattttttgtataaagat 39298921  T
178 ttaacctccattaatcgaaaatctatactcctcatttattggttgtaaatcctaaccaatgggaaaattataacatgtagtgaactatccaaatgcaaaa 277  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
39298922 ttaacctccattaatcgaaaatctgtactcctcatttattggttgtaaatcctaaccaatgggaaaattataagatgtagtgaactatccaaatgcaaaa 39299021  T
278 atgaaaggatttaaaatgtatctga 302  Q
    |||||||||||||||||||||||||    
39299022 atgaaaggatttaaaatgtatctga 39299046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 54420818 - 54420893
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    ||||||||||||||||| |||||||||||||||| |||| ||||||||||| ||||||||| |||| |||||||||    
54420818 ttgaccctaaatcacccatctttggtggatgaaggagaagaaactagggttcgtgtgacggctcacaggagagaaa 54420893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 124
Target Start/End: Original strand, 39298322 - 39298367
Alignment:
79 aattctaacgtatacttttaaaagtagagtatatcataattatata 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
39298322 aattctaacgtatacttttaaaagtagagtatatcataattatata 39298367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 40859669 - 40859609
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgg 61  Q
    ||||||||||||||||||||||||||||||||||| ||| ||||||||||||  |||||||    
40859669 ttgaccctaaatcacccctctttggtggatgaagacgaagaaactagggttttggtgacgg 40859609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 9661861 - 9661787
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaa 75  Q
    |||||||||||||||||||||||| ||||||||| |||| ||||||||||||  ||||||| ||||  |||||||    
9661861 ttgaccctaaatcacccctctttgatggatgaaggagaagaaactagggttttggtgacggctcactagagagaa 9661787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 4634291 - 4634231
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgg 61  Q
    |||||| ||||||||||||||||| ||||||||| |||| ||||||||||||  |||||||    
4634291 ttgaccttaaatcacccctctttgatggatgaaggagaagaaactagggttttggtgacgg 4634231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 1657676 - 1657727
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||||||||||||| ||||||| ||||||||| |||| ||||||||||||    
1657676 ttgaccctaaatcacctctctttgatggatgaaggagaagaaactagggttt 1657727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 16991880 - 16991829
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||||||||||||| ||||||| ||||||||| |||| ||||||||||||    
16991880 ttgaccctaaatcaccgctctttgatggatgaaggagaagaaactagggttt 16991829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 4 - 61
Target Start/End: Original strand, 1646050 - 1646107
Alignment:
4 accctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgg 61  Q
    ||||||||||| | |||||||||| ||||||||||| ||||||||||||  |||||||    
1646050 accctaaatcatctctctttggtgaatgaagaagaagaaactagggttttagtgacgg 1646107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 46729025 - 46729057
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaa 33  Q
    |||||||||||||||||||||||||||||||||    
46729025 ttgaccctaaatcacccctctttggtggatgaa 46729057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 3169048 - 3168997
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||| |||||||||| |||||||||| ||||||||||| ||||||| ||||    
3169048 ttgactctaaatcacctctctttggtgaatgaagaagaaaaaactagagttt 3168997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 3673631 - 3673580
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||||||||||||||||||||||||||| ||  |||| ||| ||||||||    
3673631 ttgaccctaaatcacccctctttggtggataaatgagaagaaagtagggttt 3673580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 15730076 - 15730127
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||| ||||||||||||||||||||||||||   || ||||||||||||    
15730076 ttgacccaaaatcacccctctttggtggatgaaggtaaagaaactagggttt 15730127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 37869522 - 37869597
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||||||||  ||||||  ||||||||| |||| ||||||||||||  ||||||| ||||  ||||||||    
37869522 ttgaccctaaatcacatctctttaatggatgaaggagaagaaactagggttttggtgacggctcacaagagagaaa 37869597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 9 - 75
Target Start/End: Original strand, 9474623 - 9474689
Alignment:
9 aaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaa 75  Q
    |||||| ||||||||||| ||||||| |||| ||||||||||||  ||||||| ||||  |||||||    
9474623 aaatcatccctctttggttgatgaaggagaagaaactagggttttggtgacggctcacaagagagaa 9474689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 14542618 - 14542656
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaa 39  Q
    |||||||||||||||||||||||| ||||||||| ||||    
14542618 ttgaccctaaatcacccctctttgatggatgaaggagaa 14542656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 46829417 - 46829379
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaa 39  Q
    ||||||||||||||||||||||| || ||||||||||||    
46829417 ttgaccctaaatcacccctctttagtagatgaagaagaa 46829379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 28588569 - 28588504
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    ||||||||||||||||| ||| || ||||||||| |||| |||||||| |||  ||||||| ||||    
28588569 ttgaccctaaatcacccttctatgatggatgaaggagaagaaactaggattttggtgacggctcac 28588504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 14)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 88 - 291
Target Start/End: Original strand, 26878388 - 26878595
Alignment:
88 gtatacttttaaaagtagagtatatcataattatatatatactattctactt-----cctgtcattatgtttgtaacaattttttg-tataaagatttaa 181  Q
    ||||||||||||||||||  |||||||||||||||||||||||||  || ||     ||||||||| |||||||| ||| |||||| |||||| ||||||    
26878388 gtatacttttaaaagtag--tatatcataattatatatatactataatattttaggccctgtcattgtgtttgtagcaaatttttggtataaatatttaa 26878485  T
182 cctccattaatcgaaaatctatactcctcatttattggttgtaaatcctaaccaatgggaaaattataacatgtagtgaactatccaaatgcaaaaatga 281  Q
    |||||||||||  ||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||    
26878486 cctccattaataaaaaatctatacccttcattcattggttgtaaatcctaaccaatgggaaaattataacatatagtgaactatccaaatgcaaatatga 26878585  T
282 aaggatttaa 291  Q
    || |||||||    
26878586 aatgatttaa 26878595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 168 - 291
Target Start/End: Original strand, 26897695 - 26897822
Alignment:
168 gtataaagatttaacctccattaatcgaaaatctatactcctcatttattggttgtaaatcctaaccaatgggaaaattataacatgtagtgaact---- 263  Q
    |||||||||||||| ||||||||||  ||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||        
26897695 gtataaagatttaatctccattaataaaaaatctatacccttcattgattggttgtaaatcctaaccaatgggaaaattataacatgtagtgaactatcc 26897794  T
264 atccaaatgcaaaaatgaaaggatttaa 291  Q
    ||||||||||||| |||||| |||||||    
26897795 atccaaatgcaaatatgaaatgatttaa 26897822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 28618612 - 28618537
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||| ||||||||||||||||||  ||||||| |||| ||||||||| ||||||||||| |||| |||||||||    
28618612 ttgaccttaaatcacccctctttggctgatgaaggagaagaaactagggcttgtgtgacggctcacaggagagaaa 28618537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 31645837 - 31645763
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaa 75  Q
    |||||||||||||||||||||||  ||||||||| |||| ||||||||||||  ||||||| ||||  |||||||    
31645837 ttgaccctaaatcacccctctttaatggatgaaggagaagaaactagggttttggtgacggctcactagagagaa 31645763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 6887284 - 6887349
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||||||||||||||||||||| ||||||||| |||| ||||||| ||||  ||||||| ||||    
6887284 ttgaccctaaatcacccctctttgatggatgaaggagaagaaactagagttttggtgacggctcac 6887349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 26898848 - 26898904
Alignment:
173 aagatttaacctccattaatcgaaaatctatactcctcatttattggttgtaaatcc 229  Q
    ||||||||||||||||||||  ||||||||||| | ||||| |||||||||||||||    
26898848 aagatttaacctccattaataaaaaatctatacccttcattcattggttgtaaatcc 26898904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 34894022 - 34894073
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||| ||||||||||||||||| ||||||||| |||| ||||||||||||    
34894022 ttgaccgtaaatcacccctctttgatggatgaaggagaagaaactagggttt 34894073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 8812258 - 8812315
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtga 58  Q
    ||||||||| ||||||||| ||||||||||||||| ||| ||||||| |||| |||||    
8812258 ttgaccctatatcacccctttttggtggatgaagatgaagaaactagagtttttgtga 8812315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 6648019 - 6648070
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||| |||||| |||||||||| ||||||||| | |||||||||||||||    
6648019 ttgaccataaatcgcccctctttgatggatgaaggaaaataaactagggttt 6648070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 52
Target Start/End: Complemental strand, 4070562 - 4070513
Alignment:
2 tgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||||||||||||||| |||||||||||||| |||| ||||||| ||||    
4070562 tgaccctaaatcacccctttttggtggatgaag-agaagaaactagagttt 4070513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 8957219 - 8957185
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaaga 35  Q
    ||||||||||| |||||||||||||||||||||||    
8957219 ttgaccctaaaccacccctctttggtggatgaaga 8957185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 52
Target Start/End: Original strand, 17326285 - 17326335
Alignment:
2 tgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||||||| |||| ||||||||||||||||||||||  || ||||||||    
17326285 tgaccctaaaccaccactctttggtggatgaagaagaagtaattagggttt 17326335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 33486676 - 33486709
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaag 34  Q
    ||||||||||||||||||||||| ||||||||||    
33486676 ttgaccctaaatcacccctctttagtggatgaag 33486709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 37425001 - 37424968
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaag 34  Q
    |||||| |||||||||||||||||||||||||||    
37425001 ttgaccataaatcacccctctttggtggatgaag 37424968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 21)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 25516502 - 25516427
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||| |||||||||    
25516502 ttgaccctaaatcacccctctttggtggatgaaggagaagaaactagggtttgtgtgacggctcacaggagagaaa 25516427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 41176870 - 41176795
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||| |||||||||    
41176870 ttgaccctaaatcacccctctttggtggatgaaggagaagaaactagggtttgtgtgacggctcacaggagagaaa 41176795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 43566884 - 43566810
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||| ||||||||||||||||||||||| |||| |||||| |||||||||||||| |||| |||||||||    
43566884 ttgaccctaa-tcacccctctttggtggatgaaggagaagaaactatggtttgtgtgacggctcacaggagagaaa 43566810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 3464967 - 3464902
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||||||||||||||||||||||||||||||| |||| ||| ||| ||||||||||||| ||||    
3464967 ttgaccctaaatcacccctctttggtggatgaaggagaagaaattagagtttgtgtgacggctcac 3464902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 25771453 - 25771379
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaa 75  Q
    |||||||||||||||||||||||| ||||||||| |||| ||||||||||||  ||||||| ||||  |||||||    
25771453 ttgaccctaaatcacccctctttgatggatgaaggagaagaaactagggttttggtgacggctcactagagagaa 25771379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 27191441 - 27191495
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtg 55  Q
    |||||||||||||| ||||||||||||||||||| |||| |||||||||||||||    
27191441 ttgaccctaaatcatccctctttggtggatgaaggagaagaaactagggtttgtg 27191495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 27841255 - 27841309
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtg 55  Q
    |||||||||||||| ||||||||||||||||||| |||| |||||||||||||||    
27841255 ttgaccctaaatcatccctctttggtggatgaaggagaagaaactagggtttgtg 27841309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 42105858 - 42105932
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaa 75  Q
    ||||||||||| |||||||||||||||||||||| | |||||| |||||||| |||||||| | ||| |||||||    
42105858 ttgaccctaaagcacccctctttggtggatgaaggaaaataaattagggtttttgtgacggctaacgagagagaa 42105932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 44167815 - 44167880
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||| || |||||||||||||||||||||||| |||| ||||||||| ||||||||||| ||||    
44167815 ttgaccatatatcacccctctttggtggatgaaggagaagaaactagggcttgtgtgacggctcac 44167880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 3390440 - 3390380
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgg 61  Q
    |||||||||||||||||||||||| ||||||||| |||| ||||||||||||  |||||||    
3390440 ttgaccctaaatcacccctctttgatggatgaaggagaagaaactagggttttggtgacgg 3390380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 44951510 - 44951463
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagg 48  Q
    |||||||||||||||||||||||||||||||||| |||| ||||||||    
44951510 ttgaccctaaatcacccctctttggtggatgaaggagaagaaactagg 44951463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 31263060 - 31263105
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaacta 46  Q
    |||||||||||||||||||||||| |||||||||||||| ||||||    
31263060 ttgaccctaaatcacccctctttgatggatgaagaagaaaaaacta 31263105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 40125394 - 40125346
Alignment:
4 accctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||||||||||||||||||||||||||| |||| |||||| |||||    
40125394 accctaaatcacccctctttggtggatgaaggagaagaaactaaggttt 40125346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 10589046 - 10588999
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagg 48  Q
    ||||||||||||||||||| ||||||||||||||| ||| ||||||||    
10589046 ttgaccctaaatcacccctttttggtggatgaagatgaagaaactagg 10588999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 36507939 - 36507881
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgac 59  Q
    |||||||||| |||||  |||||||||||||||| |||| ||||||||| |||||||||    
36507939 ttgaccctaagtcaccattctttggtggatgaaggagaagaaactagggcttgtgtgac 36507881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 37883661 - 37883623
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaa 39  Q
    |||||||||||||||||||||||||||||||||| ||||    
37883661 ttgaccctaaatcacccctctttggtggatgaaggagaa 37883623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 6089901 - 6089844
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtga 58  Q
    |||||| ||||||||||||||||| ||||||||| |||| ||| |||||||| |||||    
6089901 ttgaccttaaatcacccctctttgatggatgaaggagaagaaattagggtttttgtga 6089844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 8 - 75
Target Start/End: Original strand, 25623158 - 25623225
Alignment:
8 taaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaa 75  Q
    ||||||||||||||||| || |||||||| || ||||||||||||  ||| ||| |||| ||||||||    
25623158 taaatcacccctctttgatgtatgaagaaaaagaaactagggttttggtggcggctcacaggagagaa 25623225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 52
Target Start/End: Original strand, 27024246 - 27024296
Alignment:
2 tgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||||||||||||| |||||| ||||||||| |||| ||||||| ||||    
27024246 tgaccctaaatcacccatctttgatggatgaaggagaagaaactagagttt 27024296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 4878801 - 4878861
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgg 61  Q
    |||||||||||||||||||||||| ||| |||||  ||| ||||||| ||||  |||||||    
4878801 ttgaccctaaatcacccctctttgatgggtgaaggtgaagaaactagagttttggtgacgg 4878861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 19581109 - 19581169
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgg 61  Q
    ||||||| ||||||||||||||| ||||||||||  ||| |||||| |||||  |||||||    
19581109 ttgacccaaaatcacccctctttagtggatgaaggtgaaaaaactaaggttttggtgacgg 19581169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 13)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 5 - 80
Target Start/End: Complemental strand, 24470399 - 24470324
Alignment:
5 ccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaaagaa 80  Q
    |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||  |||||||||||||    
24470399 ccctaaatcacccctctttggtggatgaaggagaagaaactagggtttgtgtgacggctcataggagagaaaagaa 24470324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 5 - 80
Target Start/End: Complemental strand, 24475347 - 24475272
Alignment:
5 ccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaaagaa 80  Q
    |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||  |||||||||||||    
24475347 ccctaaatcacccctctttggtggatgaaggagaagaaactagggtttgtgtgacggctcataggagagaaaagaa 24475272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 49166935 - 49166860
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    ||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||| |||| |||||||||    
49166935 ttgaccctaaatcacccatctttggtggatgaaggagaagaaactagggtttgtgtgacggctcacaggagagaaa 49166860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 3 - 76
Target Start/End: Original strand, 8611730 - 8611803
Alignment:
3 gaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    ||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||  |||| |||||||||    
8611730 gaccctaaatcacccctctttcgtggatgaaggagaagaaactagggtttgtgtgacgactcacaggagagaaa 8611803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 66
Target Start/End: Complemental strand, 37399621 - 37399559
Alignment:
4 accctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||||||||||| ||||||||||||||||||||| ||| ||||||||| ||||||| ||||    
37399621 accctaaatcacccgtctttggtggatgaagaagaagaaattagggtttgcgtgacggctcac 37399559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 47749742 - 47749671
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggaga 72  Q
    |||||| ||||||||||||||||||||||||||| |||| ||| ||||||||  ||||||| |||| |||||    
47749742 ttgaccataaatcacccctctttggtggatgaaggagaagaaattagggttttcgtgacggctcacaggaga 47749671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 5237952 - 5237910
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaa 43  Q
    |||||||||||||||||||||||||||||| ||||||||||||    
5237952 ttgaccctaaatcacccctctttggtggatcaagaagaataaa 5237910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 40775275 - 40775224
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||||||||||||||||||||| ||||||||| |||| ||| ||||||||    
40775275 ttgaccctaaatcacccctctttgatggatgaaggagaagaaattagggttt 40775224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 35141859 - 35141904
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaacta 46  Q
    ||||||||||||||||| ||||||||| |||||| |||||||||||    
35141859 ttgaccctaaatcacccttctttggtgaatgaaggagaataaacta 35141904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 61
Target Start/End: Original strand, 5025171 - 5025223
Alignment:
9 aaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgg 61  Q
    ||||||||||||| ||||||||||||| ||| ||||||||||||  |||||||    
5025171 aaatcacccctctctggtggatgaagatgaagaaactagggttttggtgacgg 5025223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 28015364 - 28015313
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||||||||||||||||||| ||||||||||  ||| ||| ||||||||    
28015364 ttgaccctaaatcacccctctttagtggatgaaggtgaaaaaattagggttt 28015313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 34595756 - 34595807
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||||||| ||| |||||||||||||||||||| || ||| ||||||||    
34595756 ttgaccctaaaccactcctctttggtggatgaagaaaaagaaattagggttt 34595807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 29804782 - 29804814
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaa 33  Q
    ||||||||||| |||||||||||||||||||||    
29804782 ttgaccctaaaccacccctctttggtggatgaa 29804814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 23)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 22286855 - 22286930
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||| |||| |||||||||    
22286855 ttgaccctaaatcacccctctttggtggatgaaggagaagaaactagggcttgtgtgacggctcacaggagagaaa 22286930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 50519798 - 50519723
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    ||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||| ||||  ||||||||    
50519798 ttgaccctaaatcacccatctttggtggatgaaggagaagaaactagggtttgtgtgacggctcacaagagagaaa 50519723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 20201164 - 20201239
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||||||||||||||||||||||||||| |||| ||||||||||||  ||||||| ||||  ||||||||    
20201164 ttgaccctaaatcacccctctttggtggatgaaggagaagaaactagggttttcgtgacggctcacaagagagaaa 20201239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 20203346 - 20203421
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||||||||||||||||||||||||||| |||| ||||||||||||  ||||||| ||||  ||||||||    
20203346 ttgaccctaaatcacccctctttggtggatgaaggagaagaaactagggttttcgtgacggctcacaagagagaaa 20203421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 3 - 66
Target Start/End: Complemental strand, 20251657 - 20251594
Alignment:
3 gaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||  ||||||| ||||    
20251657 gaccctaaatcacccctctttggtggatgaaggagaataaactagggtttcggtgacggctcac 20251594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 42106119 - 42106059
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgg 61  Q
    ||||||||||||||||||||||||||||||||||| ||| ||||||||||||  |||||||    
42106119 ttgaccctaaatcacccctctttggtggatgaagatgaagaaactagggttttggtgacgg 42106059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 29776782 - 29776857
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||||||||||||||||||||||||||| |||| |||||| |||||  ||||||| ||||  ||||||||    
29776782 ttgaccctaaatcacccctctttggtggatgaaggagaaaaaactaaggttttagtgacggttcacaagagagaaa 29776857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 41882514 - 41882589
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    ||||||||||||||| |||||||| ||||||||| |||| ||||||||| |||||| |||| |||| |||||||||    
41882514 ttgaccctaaatcactcctctttgatggatgaaggagaagaaactagggcttgtgtaacggctcacaggagagaaa 41882589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 1165502 - 1165576
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaa 75  Q
    |||||||||||||||||||||||| ||||||||| |||| ||||||||||||  ||||||| ||||  |||||||    
1165502 ttgaccctaaatcacccctctttgatggatgaaggagaagaaactagggttttggtgacggctcactagagagaa 1165576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 47914689 - 47914754
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||||||||||||||||||||||||||||||| |||| ||| |||| ||| |||||||| ||||    
47914689 ttgaccctaaatcacccctctttggtggatgaaggagaagaaattaggatttctgtgacggctcac 47914754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 1806566 - 1806617
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||||||| |||||||||||||||||||||||||||  || ||||||||    
1806566 ttgaccctaaaccacccctctttggtggatgaagaagaaggaagtagggttt 1806617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 27831120 - 27831082
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaa 39  Q
    ||||||| |||||||||||||||||||||||||||||||    
27831120 ttgaccccaaatcacccctctttggtggatgaagaagaa 27831082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 52
Target Start/End: Complemental strand, 43029686 - 43029640
Alignment:
6 cctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||||||||||||||| ||||||||| |||| ||||||||||||    
43029686 cctaaatcacccctctttgatggatgaaggagaagaaactagggttt 43029640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 22844059 - 22843994
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||| ||||||| ||||||||| || |||||| |||||||||||||||||  ||||||| ||||    
22844059 ttgaccttaaatcagccctctttgatgaatgaaggagaataaactagggttttggtgacggttcac 22843994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 40797038 - 40796990
Alignment:
4 accctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||||||||||||| ||||||||| ||||| ||| ||||||||||||    
40797038 accctaaatcacccctttttggtggaggaagatgaagaaactagggttt 40796990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 21803538 - 21803463
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    ||||| || |||||| |||||||||| ||||||| |||| ||||||||||||  ||||||| ||||  ||||||||    
21803538 ttgacactgaatcactcctctttggtagatgaaggagaagaaactagggttttggtgacggctcacaagagagaaa 21803463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 40462101 - 40462152
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||| |||||||||| ||||||||||||||||  |||| ||||||||||||    
40462101 ttgactctaaatcaccactctttggtggatgaaagagaagaaactagggttt 40462152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 43839622 - 43839673
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||||||||||||| ||||| ||| |||||| |||| ||||||||||||    
43839622 ttgaccctaaatcacccatctttagtgaatgaaggagaagaaactagggttt 43839673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 4 - 66
Target Start/End: Original strand, 27056000 - 27056062
Alignment:
4 accctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||||||||||| ||| |||||||||||| |||| ||| ||||||||  ||||||| ||||    
27056000 accctaaatcacccttctctggtggatgaaggagaaaaaattagggttttggtgacggctcac 27056062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 4 - 66
Target Start/End: Original strand, 35501868 - 35501929
Alignment:
4 accctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||||||||||| |||||||||||||||| |||| |||||||| |||  ||||||| ||||    
35501868 accctaaatcaccc-tctttggtggatgaaggagaagaaactaggatttcggtgacggctcac 35501929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 66
Target Start/End: Original strand, 14741428 - 14741485
Alignment:
9 aaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    ||||||| | |||||| ||||||||| |||| |||||||||||| |||||||| ||||    
14741428 aaatcactcatctttgatggatgaaggagaaaaaactagggtttatgtgacggctcac 14741485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 11846620 - 11846572
Alignment:
4 accctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||| ||||| |||||| ||||||||||| |||| ||||||||||||    
11846620 accctatatcactcctcttaggtggatgaaggagaaaaaactagggttt 11846572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 37051632 - 37051600
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaa 33  Q
    |||||||||||||| ||||||||||||||||||    
37051632 ttgaccctaaatcatccctctttggtggatgaa 37051600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0045
Description:

Target: scaffold0045; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 9754 - 9820
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacg 67  Q
    |||||||||||||| ||||||||||||||||||| |||| |||||||||||| |||||||| |||||    
9754 ttgaccctaaatcatccctctttggtggatgaaggagaagaaactagggtttttgtgacggctcacg 9820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 8)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 16913336 - 16913271
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||||||||||||||||||||||||||||||| |||| ||||||||||||  ||||||| ||||    
16913336 ttgaccctaaatcacccctctttggtggatgaaggagaagaaactagggttttggtgacggctcac 16913271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 7049255 - 7049180
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||||||||||||||||||||||||||| |||| ||| || |||||  ||||||| ||||  ||||||||    
7049255 ttgaccctaaatcacccctctttggtggatgaaggagaaaaaattatggttttggtgacggctcacaagagagaaa 7049180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 12576584 - 12576642
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgac 59  Q
    ||||||||||||||||||||||| |||||||||| | || |||||||| ||| ||||||    
12576584 ttgaccctaaatcacccctctttcgtggatgaaggaaaagaaactaggatttttgtgac 12576642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 6 - 66
Target Start/End: Original strand, 8633275 - 8633335
Alignment:
6 cctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||||||||| ||||| |||||| |||||||| |||||||| ||| |||||||| ||||    
8633275 cctaaatcacccttctttcgtggataaagaagaagaaactaggatttttgtgacggctcac 8633335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 34020626 - 34020582
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaact 45  Q
    ||||||||||| |||||||||||||| |||||||||||| |||||    
34020626 ttgaccctaaaccacccctctttggtagatgaagaagaagaaact 34020582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 4663926 - 4663977
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||||  ||||||||||||||||||||||||| |||| ||| ||||||||    
4663926 ttgacccacaatcacccctctttggtggatgaaggagaagaaattagggttt 4663977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 10744587 - 10744541
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactag 47  Q
    ||||||||||||||||| ||||||||||||||||  ||| |||||||    
10744587 ttgaccctaaatcacccatctttggtggatgaaggtgaagaaactag 10744541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 31804280 - 31804223
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtga 58  Q
    |||| |||||||||||||||||| |||||| ||| |||| |||||| ||||| |||||    
31804280 ttgatcctaaatcacccctctttagtggataaaggagaaaaaactatggtttttgtga 31804223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 10)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 14717348 - 14717423
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||||||||||||||||||||||||||| |||| ||||||| ||||  ||||||| ||||  ||||||||    
14717348 ttgaccctaaatcacccctctttggtggatgaaggagaagaaactagagttttggtgacggctcacaagagagaaa 14717423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 22345018 - 22345092
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaa 75  Q
    |||| ||||||||||||||||||| ||||||||| |||| ||||||||||||  ||||||| ||||  |||||||    
22345018 ttgaacctaaatcacccctctttgatggatgaaggagaagaaactagggttttggtgacggctcactagagagaa 22345092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 76
Target Start/End: Complemental strand, 4564539 - 4564484
Alignment:
21 tttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||||||| |||| ||||||||||||||||||||  |||| |||||||||    
4564539 tttggtggatgaaggagaagaaactagggtttgtgtgacgactcacaggagagaaa 4564484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 22032196 - 22032261
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||||||||||| |||||||||||||||||||||  | ||| || ||||| |||||||| ||||    
22032196 ttgaccctaaatcatccctctttggtggatgaagaaataaaaattaaggtttttgtgacggctcac 22032261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 44514096 - 44514156
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgg 61  Q
    ||||||||||||||||||||||| ||||||||||  ||| ||| ||||||||  |||||||    
44514096 ttgaccctaaatcacccctctttagtggatgaaggtgaagaaattagggttttggtgacgg 44514156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 45658720 - 45658672
Alignment:
4 accctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||||||||||||||||| ||||||||  |||| ||||||||||||    
45658720 accctaaatcacccctctttgatggatgaaagagaagaaactagggttt 45658672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 30853889 - 30853940
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||| | |||||| |||||||||||||||||| |||| ||||||||||||    
30853889 ttgaccttgaatcacacctctttggtggatgaaggagaagaaactagggttt 30853940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 6212992 - 6213042
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtt 51  Q
    |||||| ||||||||||||||||| |||| |||| |||| |||||||||||    
6212992 ttgaccataaatcacccctctttgatggacgaaggagaagaaactagggtt 6213042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 27469838 - 27469884
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactag 47  Q
    |||||| ||||||||||||||||  |||||||||||||| |||||||    
27469838 ttgaccttaaatcacccctctttaatggatgaagaagaagaaactag 27469884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 76
Target Start/End: Complemental strand, 23257104 - 23257039
Alignment:
11 atcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaa 76  Q
    |||||||||||||||  ||||||| |||| ||||||||||||  ||||| | ||||| ||||||||    
23257104 atcacccctctttggcagatgaaggagaagaaactagggttttggtgacagttcacgagagagaaa 23257039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 18)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 10042769 - 10042718
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||| ||||||||||||||||||||||||||| ||||| |||||||||||    
10042769 ttgaccataaatcacccctctttggtggatgaaggagaatgaactagggttt 10042718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 16937445 - 16937496
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||||||||||||||||||||||||||||||  ||| ||||||||||||    
16937445 ttgaccctaaatcacccctctttggtggatgaaggtgaagaaactagggttt 16937496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 32256828 - 32256875
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagg 48  Q
    ||||||||||||||||||||||||||||||||||| ||| ||||||||    
32256828 ttgaccctaaatcacccctctttggtggatgaagatgaaaaaactagg 32256875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 31874092 - 31874028
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    |||||||||||||||| ||||||| ||||||||| |||| ||||||||||||| ||||||| ||||    
31874092 ttgaccctaaatcacctctctttgatggatgaaggagaagaaactagggtttg-gtgacggctcac 31874028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 37129764 - 37129815
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||| ||||||| |||| ||||||||||||| |||||||||||||||||    
37129764 ttgacccaaaatcacacctccttggtggatgaaggagaataaactagggttt 37129815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 37719859 - 37719808
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||||||||||||| || ||||||||||||| |||| ||||||||||||    
37719859 ttgaccctaaatcacccgtccttggtggatgaaggagaagaaactagggttt 37719808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 66
Target Start/End: Complemental strand, 9270022 - 9269964
Alignment:
8 taaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcac 66  Q
    ||||||||||||||||||||||||||| |||| ||||||| ||||  ||||||| ||||    
9270022 taaatcacccctctttggtggatgaaggagaagaaactagagttttcgtgacggctcac 9269964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 27534505 - 27534545
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaata 41  Q
    ||||||||||||||||||||||| |||| ||||||||||||    
27534505 ttgaccctaaatcacccctctttcgtggttgaagaagaata 27534545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 36545887 - 36545947
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgg 61  Q
    |||||| ||||||| ||||||||||||||||||| |||| |||||||| |||  |||||||    
36545887 ttgaccttaaatcatccctctttggtggatgaaggagaagaaactaggatttcagtgacgg 36545947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 37658974 - 37658942
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaa 33  Q
    |||||||||||||||||||||||||||||||||    
37658974 ttgaccctaaatcacccctctttggtggatgaa 37658942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 14327487 - 14327436
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    ||||||||||| |||||||||||||||||||||| |||| ||| ||| ||||    
14327487 ttgaccctaaaccacccctctttggtggatgaaggagaagaaattagcgttt 14327436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 23766750 - 23766691
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacg 60  Q
    |||||| ||||||||  ||||||||||||||||| |||| ||||||| |||| |||||||    
23766750 ttgaccttaaatcacatctctttggtggatgaagtagaagaaactagagtttttgtgacg 23766691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 32061802 - 32061751
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||||||||  ||||||||||||||||||||| |||| ||| ||||||||    
32061802 ttgaccctaaactacccctctttggtggatgaaggagaagaaattagggttt 32061751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 32920660 - 32920613
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagg 48  Q
    ||||||||||| |||||||||||||||||| |||||||| ||| ||||    
32920660 ttgaccctaaaccacccctctttggtggataaagaagaagaaattagg 32920613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 3680929 - 3680883
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactag 47  Q
    ||||| |||||||||||||||||||||||||||  |||| |||||||    
3680929 ttgactctaaatcacccctctttggtggatgaaagagaagaaactag 3680883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 44295324 - 44295286
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaa 39  Q
    |||||||||||||||||||||||| ||||||||| ||||    
44295324 ttgaccctaaatcacccctctttgatggatgaaggagaa 44295286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 15665547 - 15665514
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaag 34  Q
    |||||||||||||||||||||||| |||||||||    
15665547 ttgaccctaaatcacccctctttgttggatgaag 15665514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 31713141 - 31713201
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgg 61  Q
    |||||||||||||||||||||||| ||| |||||  ||| ||||||| ||||  |||||||    
31713141 ttgaccctaaatcacccctctttgatgggtgaaggtgaagaaactagagttttggtgacgg 31713201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0012 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0012
Description:

Target: scaffold0012; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 244642 - 244565
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggtttgtgtgacgggtcacgggagagaaaag 78  Q
    |||||||||||||| |||||||| ||||||||||||||| |||||  |||||  ||||||| ||||  ||||||||||    
244642 ttgaccctaaatcaaccctcttttgtggatgaagaagaagaaacttaggttttggtgacggctcacaagagagaaaag 244565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 105060 - 105009
Alignment:
1 ttgaccctaaatcacccctctttggtggatgaagaagaataaactagggttt 52  Q
    |||||| |||| |||| |||||||||||||||||||||||||| ||||||||    
105060 ttgaccttaaaccacctctctttggtggatgaagaagaataaattagggttt 105009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University