View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2280_low_8 (Length: 235)
Name: NF2280_low_8
Description: NF2280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2280_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 14 - 219
Target Start/End: Original strand, 52715483 - 52715693
Alignment:
| Q |
14 |
cttatttgggtgttctgcatttcaccgaatccgattttggttcaatttcgccatatccnnnnnnnggttggattcgtg-----tttcatttcatttcatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
52715483 |
cttatttgggtgttctgcatttcaccgaatccgattttggttcaatttcgccatatcctttttttggttggattcgtgtttcatttcatttcatttcatg |
52715582 |
T |
|
| Q |
109 |
gaccaccgcgcagacaatcaccatcgtcctggtcgtttcgtatgtattccaattccaatcaattttccatatcaatggagtttcgaattcttatgttatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52715583 |
gaccaccgcgcagacaatcaccatcgtcctggtcgtttcgtatgtattccaattccaatcaattttccatatcaatggagtttcgaattcttatgttatt |
52715682 |
T |
|
| Q |
209 |
ttgtttttctt |
219 |
Q |
| |
|
||| ||||||| |
|
|
| T |
52715683 |
ttgcttttctt |
52715693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University