View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2281_high_24 (Length: 297)
Name: NF2281_high_24
Description: NF2281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2281_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 17 - 288
Target Start/End: Original strand, 3810589 - 3810860
Alignment:
| Q |
17 |
aaaatttgacttataattggtgcaggtatgcttcggagatggctgtgatatttatccaatctgcaatatacataggaataatagcaatgacgcatttggc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3810589 |
aaaatttgacttataattggtgcaggtatgcttcggagatggctgtgatatttatccaatctgcaatatacataggaataatagcaatgacgcgtttggc |
3810688 |
T |
|
| Q |
117 |
aaggccgagcctctcaaaaatatgttttaggcgttccgataagagcatcaccctggcacacaacagcctaaaattagtagcattgtggtgcatacttgct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810689 |
aaggccgagcctctcaaaaatatgttttaggcgttccgataagagcatcaccctggcacacagcagcctaaaattagtagcattgtggtgcatacttgct |
3810788 |
T |
|
| Q |
217 |
gcttacgtaacacctgtctttatcatacctcacacaattcaccctctacttggttggatcctgtatattctt |
288 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3810789 |
gcttacgtaacaccagtctttatcatacctcacacaattcaccctctacttggttggatcctgtattttctt |
3810860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 55 - 197
Target Start/End: Complemental strand, 41672925 - 41672783
Alignment:
| Q |
55 |
atggctgtgatatttatccaatctgcaatatacataggaataatagcaatgacgcatttggcaaggccgagcctctcaaaaatatgttttaggcgttccg |
154 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| | |||||||||||| |||| | |||||||||||| |||||||||||| |||| | | || || | |
|
|
| T |
41672925 |
atggctgtgatacttattcaatcagcaatatatcttggaataatagcactgactcgtttggcaaggccaagcctctcaaaattatgctaccgccgctctg |
41672826 |
T |
|
| Q |
155 |
ataagagcatcaccctggcacacaacagcctaaaattagtagc |
197 |
Q |
| |
|
||||||||||||| ||| ||| |||| ||| ||| ||||||| |
|
|
| T |
41672825 |
ataagagcatcacattggtacaaaacatcctcaaactagtagc |
41672783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University