View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2281_high_32 (Length: 244)
Name: NF2281_high_32
Description: NF2281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2281_high_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 4 - 73
Target Start/End: Complemental strand, 5752525 - 5752456
Alignment:
| Q |
4 |
gggatgctgatacctgaattgacagcaagggaaacaactctcctccatgcggtttggcattcaattattt |
73 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5752525 |
gggaggctgatacctgaattgacagcaagggaaacaactctcctccatgcggtttggcgttcaattattt |
5752456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 149 - 229
Target Start/End: Complemental strand, 5752355 - 5752275
Alignment:
| Q |
149 |
tcctttccaaatacgggcaagttcacccaatgccaaatcccatcccttttcagtgctctttgcactgatcagattcatccc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
5752355 |
tcctttccaaatacgggcaagttcacccaattccaaatcccaacccttttcagcactctttgcacggatcagattcatccc |
5752275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 89 - 141
Target Start/End: Complemental strand, 5752452 - 5752399
Alignment:
| Q |
89 |
ttgcgaactttggatccacaagaaggtttgtaagattaggg-ttctgtcgtacg |
141 |
Q |
| |
|
||||||||| |||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
5752452 |
ttgcgaactctggatccacaagaaggttagcgagattagggtttctgtcgtacg |
5752399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University