View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2281_high_38 (Length: 211)
Name: NF2281_high_38
Description: NF2281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2281_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 12 - 90
Target Start/End: Complemental strand, 7510187 - 7510109
Alignment:
| Q |
12 |
agataattctaacaaagtctaagtttaatatatacatcatctaggctatatttggattgatggaatctgatgaagtggg |
90 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7510187 |
agataattctaacaaagtctaagcttaatatatacatcatttaggctatgtttggattgatggaatctgatgaagtggg |
7510109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 191
Target Start/End: Complemental strand, 7286714 - 7286681
Alignment:
| Q |
158 |
tttctgactatttcaatttcaagcattttgttta |
191 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
7286714 |
tttctaactatttcaatttcaagcattttgttta |
7286681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University