View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2281_low_24 (Length: 301)
Name: NF2281_low_24
Description: NF2281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2281_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 19 - 291
Target Start/End: Complemental strand, 54224699 - 54224418
Alignment:
| Q |
19 |
caaacatgtgtaaggtatgagttaaggtcacggtctaagctttcatacctcaactgttaagggtcattttcaatctgatggttttgcagggtcacgcccc |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54224699 |
caaacatgtgaaaggtatgagttaaggtcacggtctaagctttcatacctcaactgttaagggtcattttcaatctgatggttttgcagggtcacgcccc |
54224600 |
T |
 |
| Q |
119 |
tattctttttctttatttggtgtctttttctatgctcc---------ctgtcttgtttcttatcttcactggtcactgctttagtcggtattgtcttgtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54224599 |
tattctttttctttatttggtgtctttttctatgctcctttgcctttctgtcttgtttcttatcttcactggtcactgctttagtcggtattgtcttgtt |
54224500 |
T |
 |
| Q |
210 |
tccttttagtacccagacctcagtagctgtttttctttgactctttgcagcttcctaaattgtatttttcgttgcacctatg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54224499 |
tccttttagtacccagacctcagtagctgtttttctttgactctttgcagcttcctaaattgtatttttcgttgcacctatg |
54224418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University