View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2281_low_40 (Length: 211)

Name: NF2281_low_40
Description: NF2281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2281_low_40
NF2281_low_40
[»] chr5 (2 HSPs)
chr5 (12-90)||(7510109-7510187)
chr5 (158-191)||(7286681-7286714)


Alignment Details
Target: chr5 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 12 - 90
Target Start/End: Complemental strand, 7510187 - 7510109
Alignment:
12 agataattctaacaaagtctaagtttaatatatacatcatctaggctatatttggattgatggaatctgatgaagtggg 90  Q
    ||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||    
7510187 agataattctaacaaagtctaagcttaatatatacatcatttaggctatgtttggattgatggaatctgatgaagtggg 7510109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 191
Target Start/End: Complemental strand, 7286714 - 7286681
Alignment:
158 tttctgactatttcaatttcaagcattttgttta 191  Q
    ||||| ||||||||||||||||||||||||||||    
7286714 tttctaactatttcaatttcaagcattttgttta 7286681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University