View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2282_high_10 (Length: 251)

Name: NF2282_high_10
Description: NF2282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2282_high_10
NF2282_high_10
[»] chr4 (3 HSPs)
chr4 (1-175)||(39085244-39085423)
chr4 (165-238)||(39083566-39083639)
chr4 (111-212)||(39089279-39089379)


Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 39085423 - 39085244
Alignment:
1 tattttgttcttatgagagaaaataagggatgattatgaatgttgagctaacaaaaatactcaacatatgctt-ttttaagggg--nnnnnnnntactct 97  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||          ||||||    
39085423 tattttgttcttatgaga--aaataagggatgattatgaatgttgagctaacaaaaatactcaacatatgctttttttaaggggaaaaaaaaaatactct 39085326  T
98 ac----atatgtgtcgaacaaaaattgtactactattattgttttgnnnnnnnacaatattttaattgaagcattataaaat 175  Q
    ||    ||||||||||||||||||||| ||||||||||||||||||       |||||||||||||||||||||||||||||    
39085325 acatatatatgtgtcgaacaaaaattgcactactattattgttttgtttttttacaatattttaattgaagcattataaaat 39085244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 165 - 238
Target Start/End: Complemental strand, 39083639 - 39083566
Alignment:
165 cattataaaatattattttcgatacatgagttgcacgggtgtagtactctggtaaagataagataactggtcct 238  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||    
39083639 cattataaaatattatttttgatacatgagttgcacgggtgtagtactctggtaaagataagataattggtcct 39083566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 111 - 212
Target Start/End: Complemental strand, 39089379 - 39089279
Alignment:
111 acaaaaattgtactactattattgttttgnnnnnnnacaatattttaattgaagcattataaaatattattttcgatacatgagttgcacgggtgtagta 210  Q
    ||||||||||||||||||||||||||||        ||||| ||| ||||||||||||| ||||||||||||  ||||||||||  ||||||||||||||    
39089379 acaaaaattgtactactattattgtttt-tctttttacaatttttaaattgaagcattacaaaatattatttctgatacatgagaagcacgggtgtagta 39089281  T
211 ct 212  Q
    ||    
39089280 ct 39089279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University