View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2282_high_8 (Length: 279)
Name: NF2282_high_8
Description: NF2282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2282_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 46788894 - 46788643
Alignment:
| Q |
18 |
tctaccagtgtaacacaaatgatccatggtctggtgtttgttggtggctttgagagagagattactgtcgggaatgctcttataacgtcgtattttaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46788894 |
tctaccagtgtaacacaaatgatccatggtctggtgtttgttggtggctttgagagagagattactgtcgggaatgctcttataacgtcgtattttaaat |
46788795 |
T |
|
| Q |
118 |
gtgaatgttttagtcaaggaaggaaggtttttgatgaaatgattgagaggaatgttgtaacttggacggctgtgatttctggcctcgcgcaaaatgaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46788794 |
gtgaatgttttagtcaaggaaggaaggtttttgatgaaatgattgagaggaatgttgtaacttggacggctgtgatttctggcctcgcgcaaaatgaatt |
46788695 |
T |
|
| Q |
218 |
ttatgaggatagcttgaggttgtttgctcaaatgcgttgttgcgggtctgtg |
269 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46788694 |
ttatgaggatagtttgaggttgtttgctcaaatgcgttgttgcgggtctgtg |
46788643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University