View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2282_low_10 (Length: 272)
Name: NF2282_low_10
Description: NF2282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2282_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 23 - 262
Target Start/End: Original strand, 5108675 - 5108913
Alignment:
| Q |
23 |
gtcatatgtgcttataatttgggacggaaaaaactgtgaaattctcttgatcttgcaacagaataagggtctttggacttctaacgagttctgccttgtt |
122 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5108675 |
gtcatatgtgcttataatttgggatggaaaa-actgtgaaattctcttgatcttgcaacagaataagggtctttggacttctaacgagttctgccttgtt |
5108773 |
T |
|
| Q |
123 |
taacattccaaattctcttgacatttactaagttttctagtgcaacaaggccgagagacactcataactaaattttcctacactccaaaattataagcac |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5108774 |
taacattccaaattctcttgacttttactaagttttctagtgcaacaaggccgagagacactcataactaaattttcctacactccaaaattataagcac |
5108873 |
T |
|
| Q |
223 |
ctattttaattaagatcaaaacaattgtccggaagtataa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5108874 |
ctattttaattaagatcaaaacaattgtccggaagtataa |
5108913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University