View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2282_low_12 (Length: 250)
Name: NF2282_low_12
Description: NF2282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2282_low_12 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 5 - 250
Target Start/End: Complemental strand, 36588537 - 36588289
Alignment:
| Q |
5 |
gagtgagatgaaactcaagagtgtgaattaatcaatggtagttcttagttttcaggttgtgcctcagctaataa---ctccaccacaatatgctccaaga |
101 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36588537 |
gagtgtgatgaaactcaagagtgtgaattaatcaatggtagttcttagttttcaggttgtgcctcagctaataataactccaccacaatatgctccaaga |
36588438 |
T |
|
| Q |
102 |
gcaagtggtgctactattcggtgtggtatagctgaaccatctggtgaacctgctcctttaggacaaaagacacgttacgatgacagtatttttgagaagg |
201 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36588437 |
gcaagtggtgctaccattcggtgtggtatagctgaaccatctggtgaaccagctcctttaggacaaaagacacgttacaatgacagtatttttgagaagg |
36588338 |
T |
|
| Q |
202 |
ttttcatgactttgtttgcacgaaaaatggaaccatttgcagagcctgt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36588337 |
ttttcatgactttgtttgcacgaaaaatggaaccatttgcagagcctgt |
36588289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University