View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2283_low_15 (Length: 238)
Name: NF2283_low_15
Description: NF2283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2283_low_15 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 80 - 238
Target Start/End: Complemental strand, 3015599 - 3015441
Alignment:
| Q |
80 |
cttttcaaatggccacgtgcaaaatgcaacgagggtttctactttcactacttgtagcaaggtacatggtgaagttcacataagtagggtggacgatgaa |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3015599 |
cttttcaaatggccacgtgcaaaatgcaacgagggtttctactttcactacttgtagcaaggtacatggtgaaattcacataagtagggtggacgatgaa |
3015500 |
T |
|
| Q |
180 |
taagttgcacaacaatttcaatctcttttgctgtgccataaggtgtatataattttcat |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3015499 |
taagttgcacaacaatttcaatcttttttgctgtgccataaggtgtatataattttcat |
3015441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 31 - 73
Target Start/End: Complemental strand, 3015667 - 3015625
Alignment:
| Q |
31 |
gcctctcgaatttaccatggcagatattccgccaacttaaaga |
73 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3015667 |
gcctctcgaatttaccatggaagatattccgccaacttaaaga |
3015625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University