View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2284_high_10 (Length: 243)
Name: NF2284_high_10
Description: NF2284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2284_high_10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 243
Target Start/End: Complemental strand, 47706450 - 47706218
Alignment:
| Q |
15 |
aacaatagtgagtgattcatcatatactttaatcactttgtcaaaaaagaaatcttatctta----catacattaacgagttgggcaatgacttgacaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47706450 |
aacaatagtgagtgattcatcatatactttaatcactttgttaaaaaagaaatcttattttatatacatacattaacgagttgggcaatgacttgacaag |
47706351 |
T |
|
| Q |
111 |
tttacatcaattttttcttccatttgagtgatatgccttctcgtgcacggtggattattagtcccggaattgcacttgaaatcttcatcataaatattgc |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47706350 |
tttacatcaattttttcttccttttgagtgatatgccttctcgtgcacggtggattattagtcccggaattgcacttgaaatcttcatcataaatattgc |
47706251 |
T |
|
| Q |
211 |
tatgatgaacattaaaacagtcaccattcttca |
243 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
47706250 |
tatgatgaacattaaaaaagtcaccattcttca |
47706218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University