View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2284_high_13 (Length: 219)
Name: NF2284_high_13
Description: NF2284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2284_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 55 - 206
Target Start/End: Original strand, 9774559 - 9774710
Alignment:
| Q |
55 |
tacaaatcataatgtgctagcgatagttttgttttttctacgaatatatgcaagctatagggtaggttggttaggctacagttttgtttacgtggccctc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9774559 |
tacaaatcataatgtgctagcgatagttttgttttttctacgaatatatgcaagctatagggtaggttggttaggctacagttttgtttacgtggccctc |
9774658 |
T |
 |
| Q |
155 |
agtctttccagaatgtataaatgcaacttttgtgttagaataaatgaaaaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9774659 |
agtctttccagaatgtataaatgcaacttttgtgttagaataaatgaaaaaa |
9774710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University