View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2284_high_2 (Length: 458)
Name: NF2284_high_2
Description: NF2284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2284_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 17 - 448
Target Start/End: Complemental strand, 4420423 - 4419990
Alignment:
| Q |
17 |
accttcatgttatgaattgcttctgtacatgcgacttccattttgtgtgttgaaggaaccctcaaagtgtttttcacattttgttgcagatgaaaaatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4420423 |
accttcatgttatgaattgcttctgtacatgcgacttccattttgtgtgttgaaggaaccctcaaagtgtttttcacattttgttgcagatgaaaaatgt |
4420324 |
T |
|
| Q |
117 |
gcagacatgatttagggttttgttttaggttttcttcaacgtccgnnnnnnnnnnn--gggcttcctttgaacttttgtgacgaggcttgaatggagctt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
4420323 |
gcagacatgatttagggttttgttttaggttttcttcaacgtccgtttttttttttttgggcttcctttgaacttttgcgatgaggcttgaatggagctt |
4420224 |
T |
|
| Q |
215 |
caaacatgattttcttcattgccaacataaatttgagatgctataaaacatctattgctcatgacctgattcgctcgtttttcatttaatatcttttgtt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4420223 |
caaacatgattttcttcattgccaacataaatttgagatgctataaaacatctattgctcatgacctgattcgctcgtttttcatttaatatcttttgtt |
4420124 |
T |
|
| Q |
315 |
attaaatgtgatggtacaacccgtagcaagttattgtcggatttggttaacttgatatattgttactgattgatatgctactgatatctatctgcaggag |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4420123 |
attaaatgtgatggtacaacccgtagcaagttattgtcggatttggttaatttgatatattgttactgattgatatgctactgatatctatctgcaggag |
4420024 |
T |
|
| Q |
415 |
catattatcagaacatgtcatggttctgtctctg |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4420023 |
catattatcagaacatgtcatggttctgtctctg |
4419990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University