View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2284_low_3 (Length: 417)
Name: NF2284_low_3
Description: NF2284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2284_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 4e-82; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 77 - 269
Target Start/End: Complemental strand, 49070088 - 49069888
Alignment:
| Q |
77 |
tgtgacgcgaggagaaagaaggataaggcagcgcagaaagcgaaacgaatcgttttgagtatccaactccaagtagtggctgtttat----ggttgagta |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49070088 |
tgtgacgcgaggagaaagaaggataaggcagcgcagaaagcgaaacgaatcgttttgagtatccaactccaagtagtggctgtttatttatggttgagta |
49069989 |
T |
 |
| Q |
173 |
accag----gaggaagaggagaaagacagagtagcagagttggcagccatcacacggtttatccaaatttacctttcgccgttatccaaatactacgaac |
268 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49069988 |
atcaatcaagaggaagaggagaaagacagagtagcagagttggcagccatcacacggtttatccaaatttacctttcgccgttatccaaatactactaac |
49069889 |
T |
 |
| Q |
269 |
a |
269 |
Q |
| |
|
| |
|
|
| T |
49069888 |
a |
49069888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 49069812 - 49069758
Alignment:
| Q |
345 |
ctctcttcttttcttgtccatctcatataaaatgtgaaagatttatctatttatc |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49069812 |
ctctcttcttttcttgtccatctcatataaaatgtgaaagatttatctatttatc |
49069758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 49070115 - 49070086
Alignment:
| Q |
19 |
ggatttcctagcttcaacttccgtggttgt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49070115 |
ggatttcctagcttcaacttccgtggttgt |
49070086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University