View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2285_low_2 (Length: 229)
Name: NF2285_low_2
Description: NF2285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2285_low_2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 4021054 - 4020824
Alignment:
| Q |
1 |
tgtgtgctaattgagtattatcttttttaaatttcaatgaactttttgtctaatatgatttttctttcataaatatttggtgagaattagcctcatccaa |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4021054 |
tgtgtgctaattgggtattatcttttttaaatttcaatgaactttttgtctaatatgatttttctttcataaatatttggtgagaattagcctcatccaa |
4020955 |
T |
 |
| Q |
101 |
tgcattcaaccatggatttttggatgtgtctgattctcagtgacaaatattgatttggaatgaccttattatgtaaaatttagtttggttaaaagtgatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4020954 |
tgcattcaaccatggatttttggatgtgtctgattctcagtgacaaatattgatttggaatgaccttattatgtaaaatttagtttggttaaaagtgatt |
4020855 |
T |
 |
| Q |
201 |
tgaatgttaagtggt--aaatgatcggatac |
229 |
Q |
| |
|
||||||||||||||| |||||||||||||| |
|
|
| T |
4020854 |
tgaatgttaagtggtaaaaatgatcggatac |
4020824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 32051445 - 32051409
Alignment:
| Q |
168 |
attatgtaaaatttagtttggttaaaagtgatttgaa |
204 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
32051445 |
attatgtaaaatttattgtggttaaaagtgatttgaa |
32051409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University