View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2286_high_23 (Length: 237)
Name: NF2286_high_23
Description: NF2286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2286_high_23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 66 - 237
Target Start/End: Original strand, 19065197 - 19065368
Alignment:
| Q |
66 |
atcatgttcagtttctttgtgttttccacctttaaatcgttcacctttgccgccatcatttcctcttgagcctgagccatgtccacctttatttcttacc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19065197 |
atcatgttcagtttctttgtgttttccacctttaaatcgttcacctttgccgccatcatttcctcttgagcctgagccatgtccacctttatttcttacc |
19065296 |
T |
|
| Q |
166 |
cagctttcagcactcgggccgggtctcggtttccattcaacacttattttgaatttttctgttgcgccaact |
237 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19065297 |
cagctttcagcactcggcccgggtctcggtttccattcaacacttattttgaatttttctgttgcgccaact |
19065368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University